Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003937.1

Orthogroup ID

OG0005233

Physical Location & Seq

Genomic Coordinates Forward (+)

2994 .. 4919

Gene Structure 1926 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003937.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1413 bp

atgcctttgttacgtacctgtattgttttatcttctttagtgttcctcaatatccagcagggaaattattgcagaggtgaaacccaggctacctctagtagttttgctcaaacaaaaggaaaccattttgttatgaatgagagatcattctacttgaatgggttcaatgcatattggatgatgtacatggcatctgacccctctacaagggccaaggtcacttctgcattcaaacaagcctccaagtatggtatgaacattgccagaacttgggctttcagcgatggcggtagctacagaccccttcagtcttctcctggttcctataacgaagacatgttcaagggattagactttgtgatctcagaagctagaaattatggtgtgcatgtgatactgagcttggtgaacaacttcaacgattatggggggaaaaagcaatatgtgctgtgggcaaaggaacgtggccaagccataaacaacgaagacgacttctataacaacactgttgtcaaaggctactataaagatcacgttaagactgttctcacgagaatcaactccattactggggtggcttacagggatgattcaaccattttttcttgggaattaatgaacgagcctcgttgtcaacttgatccctctggaacccttctccagcaatgggtgaaagaaatggctgctcacgtcaagtccattgatagtaaccatttactggagatagggcttgaaggattctatggtggaacaaccccggaaaagaagcagttcaatcctagtaacctagaatatgggtctgatttcatagccaataacttgattcccgagattgactttgcctcgattcatatatacgctgagcaatggttacgaggggcaagtgaagaggcacaagctgattttgtggacaaatgggtcggagtacacattgaagactgtaactcagtggtaagaaaaccactaattatgggggagtttggcaaatcttacaaactgccagggtacaccatagaaaagaggaacgcctacttcgaaaaactttacaacgcacaagctgattttgtggacaaatgggtcggagtacacattgaagactgtaactcagtggtaaaaaaaccactaattatgggggagtttggcaaatcttacaaactgccagggtacaccatagaaaagaggaacgcctacttcgaaaaactttacgacgtcgtctaccgcagcgcaagcagtaacggagcatgcacaggtgcgcttttctggcagctgcttgctcaaggaatggataacttcaaagacggatatgatgtcgttctggaggagagcccttccacggctagtgtgattgctcaacaatctcacaagctaatcgagttcactaggcaacatagtaatgttacaaaaagtacttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000272 GO:0003674 GO:0003824 GO:0004553 GO:0004567 GO:0005975 GO:0005976 GO:0008150 GO:0008152 GO:0009056 GO:0009057 GO:0009987 GO:0010412 GO:0015923 GO:0016052 GO:0016787 GO:0016798 GO:0016985 GO:0016998 GO:0043170 GO:0044036 GO:0044237 GO:0044238 GO:0044247 GO:0044248 GO:0044260 GO:0044262 GO:0044264 GO:0044275 GO:0046355 GO:0071554 GO:0071704 GO:1901575

KEGG Pathways

Metabolic & Signaling

ko00051 map00051

Pfam Domains

Protein Families

Cellulase

Protein Analysis

470

Amino Acids

53.28

Weight (kDa)

6.24

Isoelectric Point (pI)

39.03

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005233)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G02310 AT1G02310
fragaria_vesca	FvH4_6g08680 FvH4_6g36270 FvH4_6g36270
malus_domestica	MD09G1170400.v1.1 MD17G1156500.v1.1
prunus_persica	Prupe.3G028800_v2.0.a1
pyrus_communis	pycom09g08810
rosa_chinensis	RchiOBHm_Chr2g0148271 RchiOBHm_Chr5g0067931
rosa_laevigata	RLG00000020331 RLG00000035944
rosa_multiflora	Rmu_sc0003937.1_g000001
rosa_roxburghii	Rroxscaffold_1G00012680 Rroxscaffold_1G00013380 Rroxscaffold_2G00098950
rosa_rugosa	Rorug02G0405200 Rorug05G0386300
rosa_samantha	Rh2AG463800 Rh2BG476900 Rh2CG450600 Rh2DG485600 Rh5AG445500 Rh5BG462900 Rh5CG484800 Rh5DG476900
rosa_wichuraiana	Rw2G037810 Rw5G041600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	2 cut(s)	917, 1076
AatII	GACGTC	1 cut(s)	1212
AccB7I	CCANNNNNTGG	2 cut(s)	270, 718
AccI	GTMKAC	1 cut(s)	1215
AciI	CCGC	2 cut(s)	288, 1219
AclWI	GGATC	1 cut(s)	635
AcoI	YGGCCR	1 cut(s)	466
AcuI	CTGAAG	1 cut(s)	290
AcyI	GRCGYC	1 cut(s)	1209
AfaI	GTAC	7 cut(s)	16, 185, 927, 1007, 1086, 1166, 1408
AfiI	CCNNNNNNNGG	6 cut(s)	207, 270, 570, 667, 718, 1333
AflIII	ACRYGT	1 cut(s)	336
AjiI	CACGTC	1 cut(s)	691
AjnI	CCWGG	4 cut(s)	84, 316, 1000, 1159
AluBI	AGCT	7 cut(s)	294, 371, 402, 899, 1058, 1267, 1366
AluI	AGCT	7 cut(s)	294, 371, 402, 899, 1058, 1267, 1366
AlwI	GGATC	1 cut(s)	635
Ama87I	CYCGRG	1 cut(s)	827
AoxI	GGCC	2 cut(s)	210, 466
ApeKI	GCWGC	4 cut(s)	683, 1221, 1264, 1267
AseI	ATTAAT	1 cut(s)	614
Asp700I	GAANNNNTTC	3 cut(s)	161, 413, 770
AspLEI	GCGC	2 cut(s)	1226, 1255
AspS9I	GGNCC	1 cut(s)	210
AsuC2I	CCSGG	1 cut(s)	758
AsuHPI	GGTGA	3 cut(s)	89, 418, 682
AsuII	TTCGAA	2 cut(s)	1035, 1194
AvaI	CYCGRG	1 cut(s)	827
BalI	TGGCCA	1 cut(s)	468
BanII	GRGCYC	1 cut(s)	1328
BauI	CACGAG	1 cut(s)	550
BbsI	GAAGAC	5 cut(s)	303, 339, 492, 942, 1101
BbvI	GCAGC	4 cut(s)	670, 1233, 1254, 1276
BccI	CCATC	1 cut(s)	278
BceAI	ACGGC	1 cut(s)	1350
BciT130I	CCWGG	4 cut(s)	86, 318, 1002, 1161
BcnI	CCSGG	1 cut(s)	758
BfaI	CTAG	6 cut(s)	96, 372, 780, 788, 1338, 1380
BfmI	CTRYAG	1 cut(s)	295
BisI	GCNGC	4 cut(s)	684, 1222, 1265, 1268
BlpI	GCTNAGC	1 cut(s)	861
BlsI	GCNGC	4 cut(s)	685, 1223, 1266, 1269
BmcAI	AGTACT	1 cut(s)	1408
Bme1390I	CCNGG	5 cut(s)	86, 318, 758, 1002, 1161
BmeT110I	CYCGRG	1 cut(s)	827
BmgBI	CACGTC	1 cut(s)	691
BmgT120I	GGNCC	1 cut(s)	210
BmiI	GGNNCC	2 cut(s)	322, 652
BmrFI	CCNGG	5 cut(s)	86, 318, 758, 1002, 1161
BmrI	ACTGGG	1 cut(s)	579
BmsI	GCATC	1 cut(s)	200
BmuI	ACTGGG	1 cut(s)	579
BpiI	GAAGAC	5 cut(s)	303, 339, 492, 942, 1101
BpmI	CTGGAG	3 cut(s)	644, 740, 1337
Bpu1102I	GCTNAGC	1 cut(s)	861
Bpu14I	TTCGAA	2 cut(s)	1035, 1194
BpuEI	CTTGAG	1 cut(s)	1260
BpuMI	CCSGG	1 cut(s)	758
BsaAI	YACGTR	1 cut(s)	14
BsaHI	GRCGYC	1 cut(s)	1209
BsaJI	CCNNGG	6 cut(s)	84, 213, 756, 1001, 1160, 1332
Bsc4I	CCNNNNNNNGG	6 cut(s)	207, 270, 570, 667, 718, 1333
Bse1I	ACTGG	2 cut(s)	574, 723
Bse3DI	GCAATG	3 cut(s)	258, 671, 872
BseBI	CCWGG	4 cut(s)	86, 318, 1002, 1161
BseDI	CCNNGG	6 cut(s)	84, 213, 756, 1001, 1160, 1332
BseGI	GGATG	2 cut(s)	183, 592
BseLI	CCNNNNNNNGG	6 cut(s)	207, 270, 570, 667, 718, 1333
BseMI	GCAATG	3 cut(s)	258, 671, 872
BseMII	CTCAG	5 cut(s)	378, 389, 852, 960, 1119
BseNI	ACTGG	2 cut(s)	574, 723
BseRI	GAGGAG	1 cut(s)	1334
BseXI	GCAGC	4 cut(s)	670, 1233, 1254, 1276
BshFI	GGCC	2 cut(s)	212, 468
BsiHKCI	CYCGRG	1 cut(s)	827
BsiSI	CCGG	1 cut(s)	758
BslI	CCNNNNNNNGG	6 cut(s)	207, 270, 570, 667, 718, 1333
BsmI	GAATGC	1 cut(s)	227
BsnI	GGCC	2 cut(s)	212, 468
BsoBI	CYCGRG	1 cut(s)	827
Bsp119I	TTCGAA	2 cut(s)	1035, 1194
Bsp1286I	GDGCHC	1 cut(s)	1328
Bsp1407I	TGTACA	1 cut(s)	183
Bsp143I	GATC	4 cut(s)	143, 360, 529, 640
Bsp1720I	GCTNAGC	1 cut(s)	861
BspACI	CCGC	2 cut(s)	288, 1219
BspANI	GGCC	2 cut(s)	212, 468
BspCNI	CTCAG	5 cut(s)	377, 390, 853, 959, 1118
BspLI	GGNNCC	2 cut(s)	322, 652
BspPI	GGATC	1 cut(s)	635
BspT104I	TTCGAA	2 cut(s)	1035, 1194
BsrDI	GCAATG	3 cut(s)	258, 671, 872
BsrGI	TGTACA	1 cut(s)	183
BsrI	ACTGG	2 cut(s)	574, 723
BssECI	CCNNGG	6 cut(s)	84, 213, 756, 1001, 1160, 1332
BssMI	GATC	4 cut(s)	143, 360, 529, 640
BssNI	GRCGYC	1 cut(s)	1209
BssSI	CACGAG	1 cut(s)	550
BssT1I	CCWWGG	1 cut(s)	213
Bst2BI	CACGAG	1 cut(s)	550
Bst2UI	CCWGG	4 cut(s)	86, 318, 1002, 1161
Bst4CI	ACNGT	4 cut(s)	508, 544, 941, 1100
Bst6I	CTCTTC	1 cut(s)	882
BstACI	GRCGYC	1 cut(s)	1209
BstAPI	GCANNNNNTGC	1 cut(s)	445
BstAUI	TGTACA	1 cut(s)	183
BstBAI	YACGTR	1 cut(s)	14
BstBI	TTCGAA	2 cut(s)	1035, 1194
BstC8I	GCNNGC	3 cut(s)	1228, 1243, 1272
BstDEI	CTNAG	5 cut(s)	364, 398, 861, 946, 1105
BstDSI	CCRYGG	1 cut(s)	1332
BstENI	CCTNNNNNAGG	1 cut(s)	205
BstF5I	GGATG	2 cut(s)	183, 592
BstHHI	GCGC	2 cut(s)	1226, 1255
BstKTI	GATC	4 cut(s)	146, 363, 532, 643
BstMBI	GATC	4 cut(s)	143, 360, 529, 640
BstMWI	GCNNNNNNNGC	3 cut(s)	445, 1227, 1261
BstNI	CCWGG	4 cut(s)	86, 318, 1002, 1161
BstNSI	RCATGY	3 cut(s)	340, 392, 1245
BstSCI	CCNGG	5 cut(s)	84, 316, 756, 1000, 1159
BstSFI	CTRYAG	1 cut(s)	295
BstSNI	TACGTA	1 cut(s)	14
BstV1I	GCAGC	4 cut(s)	670, 1233, 1254, 1276
BstV2I	GAAGAC	5 cut(s)	303, 339, 492, 942, 1101
BsuRI	GGCC	2 cut(s)	212, 468
BtgI	CCRYGG	1 cut(s)	1332
BtgZI	GCGATG	1 cut(s)	297
BtrI	CACGTC	1 cut(s)	691
BtsCI	GGATG	2 cut(s)	183, 592
BtsIMutI	CAGTG	3 cut(s)	504, 954, 1113
Cac8I	GCNNGC	3 cut(s)	1228, 1243, 1272
CfoI	GCGC	2 cut(s)	1226, 1255
Cfr13I	GGNCC	1 cut(s)	210
Csp6I	GTAC	7 cut(s)	15, 184, 926, 1006, 1085, 1165, 1407
CviAII	CATG	4 cut(s)	187, 337, 389, 1242
CviQI	GTAC	7 cut(s)	15, 184, 926, 1006, 1085, 1165, 1407
DdeI	CTNAG	5 cut(s)	364, 398, 861, 946, 1105
DpnI	GATC	4 cut(s)	145, 362, 531, 642
DpnII	GATC	4 cut(s)	143, 360, 529, 640
DrdI	GACNNNNNNGTC	2 cut(s)	917, 1076
DseDI	GACNNNNNNGTC	2 cut(s)	917, 1076
EaeI	YGGCCR	1 cut(s)	466
Eam1104I	CTCTTC	1 cut(s)	882
EarI	CTCTTC	1 cut(s)	882
Eco105I	TACGTA	1 cut(s)	14
Eco130I	CCWWGG	1 cut(s)	213
Eco24I	GRGCYC	1 cut(s)	1328
Eco57I	CTGAAG	1 cut(s)	290
Eco88I	CYCGRG	1 cut(s)	827
EcoNI	CCTNNNNNAGG	1 cut(s)	205
EcoRII	CCWGG	4 cut(s)	84, 316, 1000, 1159
EcoT14I	CCWWGG	1 cut(s)	213
EcoT22I	ATGCAT	1 cut(s)	172
EcoT38I	GRGCYC	1 cut(s)	1328
ErhI	CCWWGG	1 cut(s)	213
FaeI	CATG	4 cut(s)	190, 340, 392, 1245
FatI	CATG	4 cut(s)	186, 336, 388, 1241
FblI	GTMKAC	1 cut(s)	1215
Fnu4HI	GCNGC	4 cut(s)	684, 1222, 1265, 1268
FokI	GGATG	2 cut(s)	190, 599
FriOI	GRGCYC	1 cut(s)	1328
Fsp4HI	GCNGC	4 cut(s)	684, 1222, 1265, 1268
FspBI	CTAG	6 cut(s)	96, 372, 780, 788, 1338, 1380
GlaI	GCGC	2 cut(s)	1225, 1254
GluI	GCNGC	4 cut(s)	684, 1222, 1265, 1268
GsuI	CTGGAG	3 cut(s)	644, 740, 1337
HaeIII	GGCC	2 cut(s)	212, 468
HapII	CCGG	1 cut(s)	758
HhaI	GCGC	2 cut(s)	1226, 1255
Hin1I	GRCGYC	1 cut(s)	1209
Hin1II	CATG	4 cut(s)	190, 340, 392, 1245
Hin6I	GCGC	2 cut(s)	1224, 1253
HinP1I	GCGC	2 cut(s)	1224, 1253
HincII	GTYRAC	1 cut(s)	635
HindII	GTYRAC	1 cut(s)	635
HinfI	GANTC	5 cut(s)	555, 590, 738, 823, 847
HpaII	CCGG	1 cut(s)	758
HphI	GGTGA	3 cut(s)	89, 418, 682
Hpy188I	TCNGA	5 cut(s)	196, 367, 802, 923, 1082
Hpy188III	TCNNGA	4 cut(s)	550, 648, 827, 1316
Hpy99I	CGWCG	2 cut(s)	1211, 1214
HpyAV	CCTTC	4 cut(s)	314, 665, 728, 1338
HpyCH4III	ACNGT	4 cut(s)	508, 544, 941, 1100
HpyCH4IV	ACGT	5 cut(s)	13, 463, 534, 690, 1209
HpyCH4V	TGCA	5 cut(s)	72, 170, 227, 388, 1245
HpyF10VI	GCNNNNNNNGC	3 cut(s)	445, 1227, 1261
HpyF3I	CTNAG	5 cut(s)	364, 398, 861, 946, 1105
HpySE526I	ACGT	5 cut(s)	13, 463, 534, 690, 1209
Hsp92I	GRCGYC	1 cut(s)	1209
Hsp92II	CATG	4 cut(s)	190, 340, 392, 1245
HspAI	GCGC	2 cut(s)	1224, 1253
Kzo9I	GATC	4 cut(s)	143, 360, 529, 640
LmnI	GCTCC	1 cut(s)	1238
Lsp1109I	GCAGC	4 cut(s)	670, 1233, 1254, 1276
LweI	GCATC	1 cut(s)	200
MaeI	CTAG	6 cut(s)	96, 372, 780, 788, 1338, 1380
MaeII	ACGT	5 cut(s)	13, 463, 534, 690, 1209
MaeIII	GTNAC	9 cut(s)	9, 217, 707, 782, 870, 941, 1100, 1232, 1396
MalI	GATC	4 cut(s)	145, 362, 531, 642
MboI	GATC	4 cut(s)	143, 360, 529, 640
MboII	GAAGA	7 cut(s)	24, 303, 344, 497, 899, 947, 1106
MhlI	GDGCHC	1 cut(s)	1328
MlsI	TGGCCA	1 cut(s)	468
MluCI	AATT	5 cut(s)	64, 376, 611, 966, 1125
MluNI	TGGCCA	1 cut(s)	468
MmeI	TCCRAC	2 cut(s)	901, 1060
Mox20I	TGGCCA	1 cut(s)	468
Mph1103I	ATGCAT	1 cut(s)	172
MroXI	GAANNNNTTC	3 cut(s)	161, 413, 770
MscI	TGGCCA	1 cut(s)	468
MseI	TTAA	2 cut(s)	537, 614
MslI	CAYNNNNRTG	1 cut(s)	1392
Msp20I	TGGCCA	1 cut(s)	468
MspA1I	CMGCKG	1 cut(s)	1267
MspI	CCGG	1 cut(s)	758
MspR9I	CCNGG	5 cut(s)	86, 318, 758, 1002, 1161
Mva1269I	GAATGC	1 cut(s)	227
MvaI	CCWGG	4 cut(s)	86, 318, 1002, 1161
MwoI	GCNNNNNNNGC	3 cut(s)	445, 1227, 1261
NciI	CCSGG	1 cut(s)	758
NdeII	GATC	4 cut(s)	143, 360, 529, 640
NlaIII	CATG	4 cut(s)	190, 340, 392, 1245
NlaIV	GGNNCC	2 cut(s)	322, 652
NmuCI	GTSAC	1 cut(s)	217
NsiI	ATGCAT	1 cut(s)	172
NspI	RCATGY	3 cut(s)	340, 392, 1245
NspV	TTCGAA	2 cut(s)	1035, 1194
PaeI	GCATGC	1 cut(s)	1245
PciI	ACATGT	1 cut(s)	336
PcsI	WCGNNNNNNNCGW	2 cut(s)	1032, 1191
PctI	GAATGC	1 cut(s)	227
PdmI	GAANNNNTTC	3 cut(s)	161, 413, 770
PfeI	GAWTC	5 cut(s)	555, 590, 738, 823, 847
PflFI	GACNNNGTC	1 cut(s)	1211
PflMI	CCANNNNNTGG	2 cut(s)	270, 718
PkrI	GCNGC	4 cut(s)	685, 1223, 1266, 1269
Ppu21I	YACGTR	1 cut(s)	14
PscI	ACATGT	1 cut(s)	336
PshBI	ATTAAT	1 cut(s)	614
Psp6I	CCWGG	4 cut(s)	84, 316, 1000, 1159
PspGI	CCWGG	4 cut(s)	84, 316, 1000, 1159
PspN4I	GGNNCC	2 cut(s)	322, 652
PspPI	GGNCC	1 cut(s)	210
PsyI	GACNNNGTC	1 cut(s)	1211
PvuII	CAGCTG	1 cut(s)	1267
RsaI	GTAC	7 cut(s)	16, 185, 927, 1007, 1086, 1166, 1408
RsaNI	GTAC	7 cut(s)	15, 184, 926, 1006, 1085, 1165, 1407
RseI	CAYNNNNRTG	1 cut(s)	1392
SaqAI	TTAA	2 cut(s)	537, 614
SatI	GCNGC	4 cut(s)	684, 1222, 1265, 1268
Sau3AI	GATC	4 cut(s)	143, 360, 529, 640
Sau96I	GGNCC	1 cut(s)	210
ScaI	AGTACT	1 cut(s)	1408
ScrFI	CCNGG	5 cut(s)	86, 318, 758, 1002, 1161
SduI	GDGCHC	1 cut(s)	1328
SfaNI	GCATC	1 cut(s)	200
SfcI	CTRYAG	1 cut(s)	295
SfuI	TTCGAA	2 cut(s)	1035, 1194
SmiMI	CAYNNNNRTG	1 cut(s)	1392
SmlI	CTYRAG	1 cut(s)	1275
SmoI	CTYRAG	1 cut(s)	1275
SnaBI	TACGTA	1 cut(s)	14
SphI	GCATGC	1 cut(s)	1245
Sse9I	AATT	5 cut(s)	64, 376, 611, 966, 1125
SsiI	CCGC	2 cut(s)	288, 1219
SspMI	CTAG	6 cut(s)	96, 372, 780, 788, 1338, 1380
StyD4I	CCNGG	5 cut(s)	84, 316, 756, 1000, 1159
StyI	CCWWGG	1 cut(s)	213
TaaI	ACNGT	4 cut(s)	508, 544, 941, 1100
TaiI	ACGT	5 cut(s)	16, 466, 537, 693, 1212
TaqI	TCGA	4 cut(s)	845, 1035, 1194, 1371
TasI	AATT	5 cut(s)	64, 376, 611, 966, 1125
TatI	WGTACW	4 cut(s)	183, 925, 1084, 1406
TfiI	GAWTC	5 cut(s)	555, 590, 738, 823, 847
Tru1I	TTAA	2 cut(s)	537, 614
Tru9I	TTAA	2 cut(s)	537, 614
TscAI	CASTG	3 cut(s)	511, 954, 1113
TseFI	GTSAC	1 cut(s)	217
TseI	GCWGC	4 cut(s)	683, 1221, 1264, 1267
Tsp45I	GTSAC	1 cut(s)	217
TspDTI	ATGAA	5 cut(s)	149, 269, 632, 796, 839
TspGWI	ACGGA	2 cut(s)	1251, 1314
TspRI	CASTG	3 cut(s)	511, 954, 1113
Tth111I	GACNNNGTC	1 cut(s)	1211
Van91I	CCANNNNNTGG	2 cut(s)	270, 718
VspI	ATTAAT	1 cut(s)	614
XagI	CCTNNNNNAGG	1 cut(s)	205
XceI	RCATGY	3 cut(s)	340, 392, 1245
XcmI	CCANNNNNNNNNTGG	1 cut(s)	571
XmiI	GTMKAC	1 cut(s)	1215
XmnI	GAANNNNTTC	3 cut(s)	161, 413, 770
XspI	CTAG	6 cut(s)	96, 372, 780, 788, 1338, 1380
ZraI	GACGTC	1 cut(s)	1210
ZrmI	AGTACT	1 cut(s)	1408
Zsp2I	ATGCAT	1 cut(s)	172

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.