Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004184.1

Orthogroup ID

OG0003100

Physical Location & Seq

Genomic Coordinates Forward (+)

110960 .. 112269

Gene Structure 1310 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004184.1_g000025.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 684 bp

atgtatgttgtaaaaggaatcgaaattgggcatgagactgtttctgtgcatttgcttgagccacaatacaagcacatggctgataagattgtcctgactgtagcagaagccatgtcacttgatcctccctcacctgtgtttgtcctcgttggcgctgctctagaaactgataatccattggtaaagttggataagatgtgccttgtccctggaacgcatctggatgtcatgcttcttggtggtctcgaacagtgggaaaatggtgttgagtttgtggaaactgtggagatcttaaataaagaacatggtcacattgatgatggtgcttgtgtgaaaaacggttatctgagacctatacgagtctgtacagagtttcactacgtggctgacgtgtcgttgtctcttatatgtagcattcctacctcaattgctttgatagctgatgaacccgtaattcaacttgaagttataagaacagcaatccaggctgaccgtagttcagggagaattcgtgtcactcccattactgtggctaatgagcgcaccattagattagctgcagttggcatcactagtaatggagaagcttttgcaaactcatcatcccttcatttgcagtgggaacttagcagttgtgatgggatggcctattggaatgatgctgataatttacagagatcatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005635 GO:0005737 GO:0005783 GO:0012505 GO:0031967 GO:0031975 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044428 GO:0044444 GO:0044446 GO:0044464

KEGG Pathways

Metabolic & Signaling

ko03013 map03013

Pfam Domains

Protein Families

Big_2 RRM_1

Protein Analysis

227

Amino Acids

24.85

Weight (kDa)

4.86

Isoelectric Point (pI)

42.03

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003100)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G07920
malus_domestica	MD03G1050000.v1.1 MD11G1052200.v1.1
prunus_persica	Prupe.6G039800_v2.0.a1
pyrus_communis	pycom03g03960 pycom11g04260
rosa_chinensis	RchiOBHm_Chr1g0379851 RchiOBHm_Chr1g0379891
rosa_laevigata	RLG00000026352 RLG00000026354
rosa_multiflora	Rmu_co8429969.1_g000001 Rmu_sc0004184.1_g000024 Rmu_sc0004184.1_g000025 Rmu_sc0004184.1_g000026 Rmu_sc0014259.1_g000013
rosa_roxburghii	Rroxscaffold_4G00279870 Rroxscaffold_4G00279880
rosa_rugosa	Rorug01G0415400 Rorug01G0415500 Rorug01G0415600
rosa_samantha	Rh1AG439500 Rh1AG439600 Rh1AG439700 Rh1BG395500 Rh1BG395600 Rh1BG395700 Rh1BG395800 Rh1CG408700 Rh1CG408800 Rh1CG408900 Rh1CG409400 Rh1DG426400 Rh1DG426500 Rh1DG426600 Rh1DG426700
rosa_wichuraiana	Rw1G038260 Rw1G038270

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	470
AclWI	GGATC	1 cut(s)	116
AcsI	RAATTY	1 cut(s)	507
AdeI	CACNNNGTG	1 cut(s)	382
AfaI	GTAC	1 cut(s)	367
AflIII	ACRYGT	1 cut(s)	390
AgsI	TTSAA	2 cut(s)	458, 464
AhlI	ACTAGT	1 cut(s)	572
AjiI	CACGTC	1 cut(s)	391
AjnI	CCWGG	2 cut(s)	208, 483
AluBI	AGCT	3 cut(s)	440, 557, 587
AluI	AGCT	3 cut(s)	440, 557, 587
Alw26I	GTCTC	4 cut(s)	29, 248, 343, 405
AlwI	GGATC	1 cut(s)	116
AoxI	GGCC	1 cut(s)	645
ApeKI	GCWGC	2 cut(s)	155, 557
ApoI	RAATTY	1 cut(s)	507
AspLEI	GCGC	2 cut(s)	155, 543
AsuHPI	GGTGA	1 cut(s)	123
BbvI	GCAGC	2 cut(s)	142, 544
BccI	CCATC	3 cut(s)	314, 632, 637
BciT130I	CCWGG	2 cut(s)	210, 485
BcoDI	GTCTC	4 cut(s)	29, 248, 343, 405
BcuI	ACTAGT	1 cut(s)	572
BfaI	CTAG	2 cut(s)	161, 573
BfmI	CTRYAG	2 cut(s)	99, 558
BfoI	RGCGCY	1 cut(s)	156
BglII	AGATCT	1 cut(s)	288
BisI	GCNGC	2 cut(s)	156, 558
BlsI	GCNGC	2 cut(s)	157, 559
Bme1390I	CCNGG	2 cut(s)	210, 485
BmgBI	CACGTC	1 cut(s)	391
BmrFI	CCNGG	2 cut(s)	210, 485
BmsI	GCATC	3 cut(s)	226, 576, 649
BpuEI	CTTGAG	1 cut(s)	77
BsaAI	YACGTR	1 cut(s)	382
BsaI	GGTCTC	2 cut(s)	248, 343
BsaJI	CCNNGG	1 cut(s)	208
BsaXI	ACNNNNNCTCC	2 cut(s)	496, 526
BseBI	CCWGG	2 cut(s)	210, 485
BseDI	CCNNGG	1 cut(s)	208
BseGI	GGATG	3 cut(s)	229, 602, 648
BseMII	CTCAG	1 cut(s)	338
BseXI	GCAGC	2 cut(s)	142, 544
BshFI	GGCC	1 cut(s)	647
BslFI	GGGAC	1 cut(s)	191
BsmAI	GTCTC	4 cut(s)	29, 248, 343, 405
BsmFI	GGGAC	1 cut(s)	191
BsmI	GAATGC	1 cut(s)	414
BsnI	GGCC	1 cut(s)	647
Bso31I	GGTCTC	2 cut(s)	248, 343
Bsp1407I	TGTACA	1 cut(s)	365
Bsp143I	GATC	3 cut(s)	121, 288, 677
BspANI	GGCC	1 cut(s)	647
BspCNI	CTCAG	1 cut(s)	339
BspMAI	CTGCAG	1 cut(s)	562
BspPI	GGATC	1 cut(s)	116
BspTNI	GGTCTC	2 cut(s)	248, 343
BsrGI	TGTACA	1 cut(s)	365
BssECI	CCNNGG	1 cut(s)	208
BssMI	GATC	3 cut(s)	121, 288, 677
Bst2UI	CCWGG	2 cut(s)	210, 485
Bst4CI	ACNGT	7 cut(s)	40, 100, 252, 283, 341, 494, 529
BstAUI	TGTACA	1 cut(s)	365
BstBAI	YACGTR	1 cut(s)	382
BstDEI	CTNAG	2 cut(s)	347, 626
BstF5I	GGATG	3 cut(s)	229, 602, 648
BstH2I	RGCGCY	1 cut(s)	156
BstHHI	GCGC	2 cut(s)	155, 543
BstKTI	GATC	3 cut(s)	124, 291, 680
BstMAI	GTCTC	4 cut(s)	29, 248, 343, 405
BstMBI	GATC	3 cut(s)	121, 288, 677
BstMWI	GCNNNNNNNGC	2 cut(s)	437, 485
BstNI	CCWGG	2 cut(s)	210, 485
BstSCI	CCNGG	2 cut(s)	208, 483
BstSFI	CTRYAG	2 cut(s)	99, 558
BstV1I	GCAGC	2 cut(s)	142, 544
BstX2I	RGATCY	1 cut(s)	288
BstXI	CCANNNNNNTGG	1 cut(s)	529
BstYI	RGATCY	1 cut(s)	288
BsuRI	GGCC	1 cut(s)	647
BtrI	CACGTC	1 cut(s)	391
BtsCI	GGATG	3 cut(s)	229, 602, 648
BtsI	GCAGTG	1 cut(s)	623
BtsIMutI	CAGTG	2 cut(s)	257, 623
CfoI	GCGC	2 cut(s)	155, 543
Csp6I	GTAC	1 cut(s)	366
CviAII	CATG	5 cut(s)	32, 76, 112, 229, 305
CviQI	GTAC	1 cut(s)	366
DdeI	CTNAG	2 cut(s)	347, 626
DpnI	GATC	3 cut(s)	123, 290, 679
DpnII	GATC	3 cut(s)	121, 288, 677
DraIII	CACNNNGTG	1 cut(s)	382
Eco31I	GGTCTC	2 cut(s)	248, 343
EcoRI	GAATTC	1 cut(s)	507
EcoRII	CCWGG	2 cut(s)	208, 483
FaeI	CATG	5 cut(s)	35, 79, 115, 232, 308
FaqI	GGGAC	1 cut(s)	191
FatI	CATG	5 cut(s)	31, 75, 111, 228, 304
Fnu4HI	GCNGC	2 cut(s)	156, 558
FokI	GGATG	3 cut(s)	236, 589, 655
Fsp4HI	GCNGC	2 cut(s)	156, 558
FspBI	CTAG	2 cut(s)	161, 573
GlaI	GCGC	2 cut(s)	154, 542
GluI	GCNGC	2 cut(s)	156, 558
HaeII	RGCGCY	1 cut(s)	156
HaeIII	GGCC	1 cut(s)	647
HhaI	GCGC	2 cut(s)	155, 543
Hin1II	CATG	5 cut(s)	35, 79, 115, 232, 308
Hin6I	GCGC	2 cut(s)	153, 541
HinP1I	GCGC	2 cut(s)	153, 541
HindIII	AAGCTT	1 cut(s)	585
HinfI	GANTC	2 cut(s)	18, 360
HphI	GGTGA	1 cut(s)	123
Hpy188I	TCNGA	1 cut(s)	348
Hpy188III	TCNNGA	4 cut(s)	94, 161, 221, 245
HpyAV	CCTTC	1 cut(s)	617
HpyCH4III	ACNGT	7 cut(s)	40, 100, 252, 283, 341, 494, 529
HpyCH4IV	ACGT	2 cut(s)	381, 390
HpyCH4V	TGCA	4 cut(s)	49, 560, 593, 616
HpyF10VI	GCNNNNNNNGC	2 cut(s)	437, 485
HpyF3I	CTNAG	2 cut(s)	347, 626
HpySE526I	ACGT	2 cut(s)	381, 390
Hsp92II	CATG	5 cut(s)	35, 79, 115, 232, 308
HspAI	GCGC	2 cut(s)	153, 541
Kzo9I	GATC	3 cut(s)	121, 288, 677
LpnPI	CCDG	8 cut(s)	107, 147, 195, 206, 222, 470, 486, 497
Lsp1109I	GCAGC	2 cut(s)	142, 544
LweI	GCATC	3 cut(s)	226, 576, 649
MaeI	CTAG	2 cut(s)	161, 573
MaeII	ACGT	2 cut(s)	381, 390
MaeIII	GTNAC	3 cut(s)	114, 308, 514
MalI	GATC	3 cut(s)	123, 290, 679
MboI	GATC	3 cut(s)	121, 288, 677
MfeI	CAATTG	1 cut(s)	426
MflI	RGATCY	1 cut(s)	288
MluCI	AATT	5 cut(s)	24, 426, 453, 507, 667
MlyI	GAGTC	1 cut(s)	369
MmeI	TCCRAC	1 cut(s)	168
MnlI	CCTC	4 cut(s)	135, 139, 155, 433
MseI	TTAA	1 cut(s)	293
MslI	CAYNNNNRTG	3 cut(s)	222, 315, 527
MspR9I	CCNGG	2 cut(s)	210, 485
MunI	CAATTG	1 cut(s)	426
Mva1269I	GAATGC	1 cut(s)	414
MvaI	CCWGG	2 cut(s)	210, 485
MwoI	GCNNNNNNNGC	2 cut(s)	437, 485
NdeII	GATC	3 cut(s)	121, 288, 677
NlaIII	CATG	5 cut(s)	35, 79, 115, 232, 308
NmuCI	GTSAC	3 cut(s)	114, 308, 514
PcsI	WCGNNNNNNNCGW	1 cut(s)	387
PctI	GAATGC	1 cut(s)	414
PfeI	GAWTC	1 cut(s)	18
PkrI	GCNGC	2 cut(s)	157, 559
PleI	GAGTC	1 cut(s)	368
PpsI	GAGTC	1 cut(s)	368
Ppu21I	YACGTR	1 cut(s)	382
PsiI	TTATAA	1 cut(s)	470
Psp6I	CCWGG	2 cut(s)	208, 483
PspGI	CCWGG	2 cut(s)	208, 483
PstI	CTGCAG	1 cut(s)	562
PsuI	RGATCY	1 cut(s)	288
RsaI	GTAC	1 cut(s)	367
RsaNI	GTAC	1 cut(s)	366
RseI	CAYNNNNRTG	3 cut(s)	222, 315, 527
SaqAI	TTAA	1 cut(s)	293
SatI	GCNGC	2 cut(s)	156, 558
Sau3AI	GATC	3 cut(s)	121, 288, 677
SchI	GAGTC	1 cut(s)	369
ScrFI	CCNGG	2 cut(s)	210, 485
SetI	ASST	8 cut(s)	136, 355, 384, 393, 425, 442, 559, 589
SfaNI	GCATC	3 cut(s)	226, 576, 649
SfcI	CTRYAG	2 cut(s)	99, 558
SmiMI	CAYNNNNRTG	3 cut(s)	222, 315, 527
SmlI	CTYRAG	1 cut(s)	56
SmoI	CTYRAG	1 cut(s)	56
SpeI	ACTAGT	1 cut(s)	572
Sse9I	AATT	5 cut(s)	24, 426, 453, 507, 667
SspMI	CTAG	2 cut(s)	161, 573
StyD4I	CCNGG	2 cut(s)	208, 483
TaaI	ACNGT	7 cut(s)	40, 100, 252, 283, 341, 494, 529
TaiI	ACGT	2 cut(s)	384, 393
TaqI	TCGA	2 cut(s)	21, 246
TasI	AATT	5 cut(s)	24, 426, 453, 507, 667
TatI	WGTACW	1 cut(s)	365
TfiI	GAWTC	1 cut(s)	18
Tru1I	TTAA	1 cut(s)	293
Tru9I	TTAA	1 cut(s)	293
TscAI	CASTG	2 cut(s)	257, 623
TseFI	GTSAC	3 cut(s)	114, 308, 514
TseI	GCWGC	2 cut(s)	155, 557
Tsp45I	GTSAC	3 cut(s)	114, 308, 514
TspDTI	ATGAA	2 cut(s)	459, 599
TspRI	CASTG	2 cut(s)	257, 623
XapI	RAATTY	1 cut(s)	507
XbaI	TCTAGA	1 cut(s)	160
XspI	CTAG	2 cut(s)	161, 573

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.