Rmu_sc0004483.1_g000025

Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004483.1
Physical Location & Seq
Forward (+)
90098 .. 90409
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004483.1_g000025.1.cds

Sequence Viewer

Length: 312 bp
atgtcaggaagaggaaagggagggaaggggttggggaaaggcggagcaaagaggcacaggaaggtgctgagggacaacatccagggcatcaccaagcctgcgattcggaggctcgctcgaagaggaggagtgaagcgcattagtgggcttatctatgaagaaaccagaggggtgctcaagatcttcttggagaatgtgattcgcgatgcggtgacttatactgagcatgctaggaggaagactgtgaccgccatggatgtcgtctatgctctcaagaggcagggccgaaccctctatggtttcggtggttag

Protein Analysis

103

Amino Acids

11.41

Weight (kDa)

11.48

Isoelectric Point (pI)

45.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000524)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G07660 AT1G07820 AT1G07820 AT2G28740 AT3G45930 AT3G46320 AT3G53730 AT5G59690 AT5G59970 AT5G59970
malus_domestica MD03G1097000.v1.1 MD03G1105400.v1.1 MD04G1124800.v1.1 MD06G1122500.v1.1 MD07G1184400.v1.1 MD07G1194500.v1.1 MD11G1143500.v1.1 MD12G1139800.v1.1 MD14G1139400.v1.1 MD15G1139200.v1.1
rosa_chinensis RchiOBHm_Chr1g0364991 RchiOBHm_Chr3g0467051 RchiOBHm_Chr5g0062221 RchiOBHm_Chr5g0063251 RchiOBHm_Chr5g0063281 RchiOBHm_Chr5g0063731 RchiOBHm_Chr7g0187711
rosa_laevigata RLG00000024533
rosa_multiflora Rmu_sc0004483.1_g000025 Rmu_sc0005045.1_g000017 Rmu_sc0005045.1_g000024 Rmu_sc0005638.1_g000003 Rmu_sc0042820.1_g000002 Rmu_sc0042820.1_g000003 Rmu_ssc0000112.1_g000021 Rmu_ssc0000309.1_g000047 Rmu_ssc0000409.1_g000022
rosa_roxburghii Rroxscaffold_1G00017140 Rroxscaffold_1G00017150 Rroxscaffold_1G00017430 Rroxscaffold_1G00017460 Rroxscaffold_4G00292020 Rroxscaffold_6G00413990
rosa_rugosa Rorug01G0318800 Rorug01G0329200 Rorug03G0085000 Rorug05G0347300 Rorug05G0355600 Rorug05G0355800 Rorug05G0358800 Rorug05G0358800 Rorug05G0358900 Rorug06G0483800
rosa_samantha Rh1AG327700 Rh1BG289000 Rh1CG305700 Rh1DG320500 Rh3AG133000 Rh3BG154000 Rh3CG154000 Rh3DG155100 Rh5AG407800 Rh5AG417800 Rh5BG421500 Rh5BG430300 Rh5BG433000 Rh5BG433200 Rh5CG445700 Rh5CG456200 Rh5CG456400 Rh5DG436500 Rh5DG443700 Rh5DG443900 Rh5DG446400 Rh5DG446600 Rh7BG090600 Rh7CG089600 Rh7DG091100
rosa_wichuraiana Rw1G029050 Rw3G012590 Rw5G038430 Rw5G039030 Rw5G039230 Rw5G039250 Rw7G007670

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 204
AciI CCGC 3 cut(s) 42, 209, 249
AjnI CCWGG 1 cut(s) 81
Alw21I GWGCWC 1 cut(s) 177
AoxI GGCC 1 cut(s) 283
AspLEI GCGC 1 cut(s) 138
AspS9I GGNCC 1 cut(s) 283
AsuHPI GGTGA 2 cut(s) 82, 223
BbsI GAAGAC 1 cut(s) 245
Bbv12I GWGCWC 1 cut(s) 177
BbvCI CCTCAGC 1 cut(s) 68
BciT130I CCWGG 1 cut(s) 83
BfaI CTAG 1 cut(s) 231
BglII AGATCT 1 cut(s) 180
Bme1390I CCNGG 1 cut(s) 83
BmgT120I GGNCC 1 cut(s) 283
BmrFI CCNGG 1 cut(s) 83
BmsI GCATC 2 cut(s) 96, 196
BpiI GAAGAC 1 cut(s) 245
BplI GAGNNNNNCTC 4 cut(s) 100, 132, 159, 191
Bpu10I CCTNAGC 1 cut(s) 68
BpuEI CTTGAG 2 cut(s) 161, 257
BsaJI CCNNGG 2 cut(s) 82, 252
BseBI CCWGG 1 cut(s) 83
BseDI CCNNGG 2 cut(s) 82, 252
BseGI GGATG 2 cut(s) 78, 262
BseMII CTCAG 2 cut(s) 59, 213
BseRI GAGGAG 2 cut(s) 138, 141
Bsh1236I CGCG 1 cut(s) 204
BshFI GGCC 1 cut(s) 285
BsiHKAI GWGCWC 1 cut(s) 177
BslFI GGGAC 1 cut(s) 86
BsmFI GGGAC 1 cut(s) 86
BsnI GGCC 1 cut(s) 285
Bsp1286I GDGCHC 1 cut(s) 177
Bsp143I GATC 1 cut(s) 180
Bsp19I CCATGG 1 cut(s) 252
Bsp68I TCGCGA 1 cut(s) 204
BspACI CCGC 3 cut(s) 42, 209, 249
BspANI GGCC 1 cut(s) 285
BspCNI CTCAG 2 cut(s) 60, 214
BspFNI CGCG 1 cut(s) 204
BssECI CCNNGG 2 cut(s) 82, 252
BssMI GATC 1 cut(s) 180
BssT1I CCWWGG 1 cut(s) 252
Bst2UI CCWGG 1 cut(s) 83
Bst4CI ACNGT 1 cut(s) 244
Bst6I CTCTTC 2 cut(s) 4, 115
BstC8I GCNNGC 3 cut(s) 99, 114, 228
BstDEI CTNAG 2 cut(s) 68, 222
BstDSI CCRYGG 1 cut(s) 252
BstF5I GGATG 2 cut(s) 78, 262
BstFNI CGCG 1 cut(s) 204
BstHHI GCGC 1 cut(s) 138
BstKTI GATC 1 cut(s) 183
BstMBI GATC 1 cut(s) 180
BstNI CCWGG 1 cut(s) 83
BstNSI RCATGY 1 cut(s) 230
BstSCI CCNGG 1 cut(s) 81
BstUI CGCG 1 cut(s) 204
BstV2I GAAGAC 1 cut(s) 245
BstX2I RGATCY 1 cut(s) 180
BstYI RGATCY 1 cut(s) 180
BsuRI GGCC 1 cut(s) 285
BtgI CCRYGG 1 cut(s) 252
BtgZI GCGATG 1 cut(s) 219
BtsCI GGATG 2 cut(s) 78, 262
BtuMI TCGCGA 1 cut(s) 204
Cac8I GCNNGC 3 cut(s) 99, 114, 228
CfoI GCGC 1 cut(s) 138
Cfr13I GGNCC 1 cut(s) 283
CviAII CATG 2 cut(s) 227, 253
CviJI RGCY 4 cut(s) 97, 112, 148, 285
CviKI_1 RGCY 4 cut(s) 97, 112, 148, 285
DdeI CTNAG 2 cut(s) 68, 222
DpnI GATC 1 cut(s) 182
DpnII GATC 1 cut(s) 180
Eam1104I CTCTTC 2 cut(s) 4, 115
EarI CTCTTC 2 cut(s) 4, 115
EciI GGCGGA 1 cut(s) 57
Eco130I CCWWGG 1 cut(s) 252
EcoRII CCWGG 1 cut(s) 81
EcoT14I CCWWGG 1 cut(s) 252
ErhI CCWWGG 1 cut(s) 252
FaeI CATG 2 cut(s) 230, 256
FaiI YATR 6 cut(s) 156, 219, 228, 254, 267, 297
FalI AAGNNNNNCTT 2 cut(s) 170, 202
FaqI GGGAC 1 cut(s) 86
FatI CATG 2 cut(s) 226, 252
FokI GGATG 2 cut(s) 65, 269
FspBI CTAG 1 cut(s) 231
GlaI GCGC 1 cut(s) 137
HaeIII GGCC 1 cut(s) 285
HhaI GCGC 1 cut(s) 138
Hin1II CATG 2 cut(s) 230, 256
Hin6I GCGC 1 cut(s) 136
HinP1I GCGC 1 cut(s) 136
HinfI GANTC 2 cut(s) 103, 199
HphI GGTGA 2 cut(s) 82, 223
Hpy188I TCNGA 1 cut(s) 108
Hpy188III TCNNGA 4 cut(s) 6, 178, 203, 274
HpyAV CCTTC 2 cut(s) 19, 55
HpyCH4III ACNGT 1 cut(s) 244
HpyF3I CTNAG 2 cut(s) 68, 222
Hsp92II CATG 2 cut(s) 230, 256
HspAI GCGC 1 cut(s) 136
Kzo9I GATC 1 cut(s) 180
LmnI GCTCC 1 cut(s) 44
LpnPI CCDG 6 cut(s) 43, 68, 95, 111, 178, 266
LweI GCATC 2 cut(s) 96, 196
MaeI CTAG 1 cut(s) 231
MaeIII GTNAC 2 cut(s) 211, 244
MalI GATC 1 cut(s) 182
MboI GATC 1 cut(s) 180
MboII GAAGA 5 cut(s) 21, 132, 170, 175, 250
MflI RGATCY 1 cut(s) 180
MhlI GDGCHC 1 cut(s) 177
MspR9I CCNGG 1 cut(s) 83
MvaI CCWGG 1 cut(s) 83
MvnI CGCG 1 cut(s) 204
NcoI CCATGG 1 cut(s) 252
NdeII GATC 1 cut(s) 180
NlaIII CATG 2 cut(s) 230, 256
NmuCI GTSAC 2 cut(s) 211, 244
NruI TCGCGA 1 cut(s) 204
NspI RCATGY 1 cut(s) 230
PaeI GCATGC 1 cut(s) 230
PfeI GAWTC 2 cut(s) 103, 199
Psp6I CCWGG 1 cut(s) 81
PspGI CCWGG 1 cut(s) 81
PspPI GGNCC 1 cut(s) 283
PsuI RGATCY 1 cut(s) 180
RruI TCGCGA 1 cut(s) 204
Sau3AI GATC 1 cut(s) 180
Sau96I GGNCC 1 cut(s) 283
ScrFI CCNGG 1 cut(s) 83
SduI GDGCHC 1 cut(s) 177
SetI ASST 1 cut(s) 66
SfaNI GCATC 2 cut(s) 96, 196
SmlI CTYRAG 2 cut(s) 176, 272
SmoI CTYRAG 2 cut(s) 176, 272
SphI GCATGC 1 cut(s) 230
SsiI CCGC 3 cut(s) 42, 209, 249
SspMI CTAG 1 cut(s) 231
StyD4I CCNGG 1 cut(s) 81
StyI CCWWGG 1 cut(s) 252
TaaI ACNGT 1 cut(s) 244
TaqI TCGA 1 cut(s) 118
TfiI GAWTC 2 cut(s) 103, 199
TseFI GTSAC 2 cut(s) 211, 244
Tsp45I GTSAC 2 cut(s) 211, 244
TspDTI ATGAA 1 cut(s) 171
XceI RCATGY 1 cut(s) 230
XspI CTAG 1 cut(s) 231
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.