Rorug05G0355600

Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Forward (+)
44633310 .. 44633462
153 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0355600.1

Sequence Viewer

Length: 153 bp
ATGAAGTTACAGACTTACAGTTACAATAGGGAGCTTTGGATAATTGATTTCTGTTGCTTTGATTCAATTATAGGGTTGAGGCTTCTGGGTAAGTGGGTATTAAGGCTTTGGAGTCGATTAATTTCTGTTTGCTTGATAGATTTATATGGTTAA

Protein Analysis

50

Amino Acids

6.03

Weight (kDa)

8.59

Isoelectric Point (pI)

39.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000524)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G07660 AT1G07820 AT1G07820 AT2G28740 AT3G45930 AT3G46320 AT3G53730 AT5G59690 AT5G59970 AT5G59970
malus_domestica MD03G1097000.v1.1 MD03G1105400.v1.1 MD04G1124800.v1.1 MD06G1122500.v1.1 MD07G1184400.v1.1 MD07G1194500.v1.1 MD11G1143500.v1.1 MD12G1139800.v1.1 MD14G1139400.v1.1 MD15G1139200.v1.1
rosa_chinensis RchiOBHm_Chr1g0364991 RchiOBHm_Chr3g0467051 RchiOBHm_Chr5g0062221 RchiOBHm_Chr5g0063251 RchiOBHm_Chr5g0063281 RchiOBHm_Chr5g0063731 RchiOBHm_Chr7g0187711
rosa_laevigata RLG00000024533
rosa_multiflora Rmu_sc0004483.1_g000025 Rmu_sc0005045.1_g000017 Rmu_sc0005045.1_g000024 Rmu_sc0005638.1_g000003 Rmu_sc0042820.1_g000002 Rmu_sc0042820.1_g000003 Rmu_ssc0000112.1_g000021 Rmu_ssc0000309.1_g000047 Rmu_ssc0000409.1_g000022
rosa_roxburghii Rroxscaffold_1G00017140 Rroxscaffold_1G00017150 Rroxscaffold_1G00017430 Rroxscaffold_1G00017460 Rroxscaffold_4G00292020 Rroxscaffold_6G00413990
rosa_rugosa Rorug01G0318800 Rorug01G0329200 Rorug03G0085000 Rorug05G0347300 Rorug05G0355600 Rorug05G0355800 Rorug05G0358800 Rorug05G0358800 Rorug05G0358900 Rorug06G0483800
rosa_samantha Rh1AG327700 Rh1BG289000 Rh1CG305700 Rh1DG320500 Rh3AG133000 Rh3BG154000 Rh3CG154000 Rh3DG155100 Rh5AG407800 Rh5AG417800 Rh5BG421500 Rh5BG430300 Rh5BG433000 Rh5BG433200 Rh5CG445700 Rh5CG456200 Rh5CG456400 Rh5DG436500 Rh5DG443700 Rh5DG443900 Rh5DG446400 Rh5DG446600 Rh7BG090600 Rh7CG089600 Rh7DG091100
rosa_wichuraiana Rw1G029050 Rw3G012590 Rw5G038430 Rw5G039030 Rw5G039230 Rw5G039250 Rw7G007670

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 66
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
AseI ATTAAT 1 cut(s) 119
Bst4CI ACNGT 1 cut(s) 20
CviJI RGCY 3 cut(s) 34, 82, 106
CviKI_1 RGCY 3 cut(s) 34, 82, 106
FaiI YATR 3 cut(s) 71, 145, 147
HinfI GANTC 2 cut(s) 62, 112
HpyCH4III ACNGT 1 cut(s) 20
LmnI GCTCC 1 cut(s) 31
LpnPI CCDG 1 cut(s) 71
MaeIII GTNAC 2 cut(s) 6, 20
MluCI AATT 3 cut(s) 42, 66, 120
MlyI GAGTC 1 cut(s) 121
MnlI CCTC 1 cut(s) 72
MseI TTAA 3 cut(s) 101, 119, 151
PfeI GAWTC 1 cut(s) 62
PleI GAGTC 1 cut(s) 120
PpsI GAGTC 1 cut(s) 120
PshBI ATTAAT 1 cut(s) 119
SaqAI TTAA 3 cut(s) 101, 119, 151
SchI GAGTC 1 cut(s) 121
SetI ASST 1 cut(s) 36
SgeI CNNG 2 cut(s) 98, 145
Sse9I AATT 3 cut(s) 42, 66, 120
TaaI ACNGT 1 cut(s) 20
TaqI TCGA 1 cut(s) 115
TasI AATT 3 cut(s) 42, 66, 120
TfiI GAWTC 1 cut(s) 62
Tru1I TTAA 3 cut(s) 101, 119, 151
Tru9I TTAA 3 cut(s) 101, 119, 151
TspDTI ATGAA 1 cut(s) 17
VspI ATTAAT 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.