Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004483.1

Orthogroup ID

OG0004266

Physical Location & Seq

Genomic Coordinates Reverse (-)

127220 .. 128762

Gene Structure 1543 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004483.1_g000036.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1062 bp

atggacaatcactcccaatatgctatgcagctagtaagcgcatcattagcgcctatggtgcttaaagcagccatagaacttggtgtgctcgacataatacacagagctggccctggagttcagctttcatcttctgaaatagcgtcacagctcccctctcacaacaaccccggtgctcctgtagtgcttgatcgtatgcttcgccttctgtctgctcactccattctcacttgctcagtttccactgatgaagctgatcatgtgaaggttctgaggctttatggtttggcaccggttgccaagtacttcattctggaccaggatggaggatcattagcaactttactaaatttttgccatgacaaggtcaacacagatagctggtaccatttgacagatgtagttttggaaggaggagttccatttaccaaggcctatggcatgagtgtggtggagtacaacgcaaaagatgcaagatatggtgaaacattcaggaactcaatgaaagagtttaaccctgtttttatgaaggaaatccttgggagttataagggttttgaaggtctaggtacactcgtagatgcgggtggtggtgatggtactatccttaacatgattgtctccaagtaccctaccatcaagggtatcaactatgatttggctgctgttatagaaaaatctccctcctatcctggtattgagcatattgcaggggatatctttgtaaacattccgaaaggagatgccattttcatgaagtggatactacaccattacgatgacaaaagttgctcgacgatactaaaaaactgctatgaggcattgccagaccatggaaaagtcatagtggttgatatggtgataccggaagcccctgaaactactacttctgcaaaaagcttgtttcagtttgatatgttcatgatgaacatgaacaccaatggaaatgagagaacagagaaagaacttggaagtttggcaaaacaagccgggttttacaccattcgagtggcatgttctgcatttaacttttcggtggtggagatgttcaagaacatgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Dimerisation Methyltransf_2

Protein Analysis

353

Amino Acids

38.73

Weight (kDa)

5.55

Isoelectric Point (pI)

36.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004266)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G33030 AT1G33030 AT1G33030
fragaria_vesca	FvH4_5g10440
malus_domestica	MD14G1140100.v1.1 MD14G1140300.v1.1 MD14G1140600.v1.1 MD14G1140900.v1.1
prunus_persica	Prupe.5G134400_v2.0.a1 Prupe.5G134400_v2.0.a1
pyrus_communis	pycom14g11580
rosa_chinensis	RchiOBHm_Chr7g0187771 RchiOBHm_Chr7g0187791
rosa_laevigata	RLG00000004756 RLG00000004757
rosa_multiflora	Rmu_sc0004483.1_g000030 Rmu_sc0004483.1_g000036
rosa_roxburghii	Rroxscaffold_3G00267080 Rroxscaffold_3G00267090
rosa_rugosa	Rorug06G0484100.1 Rorug06G0484200
rosa_samantha	Rh7AG089200 Rh7AG089400 Rh7BG091000 Rh7BG091100 Rh7CG090000 Rh7CG090100 Rh7CG090200 Rh7DG091600 Rh7DG091800
rosa_wichuraiana	Rw7G007700 Rw7G007710

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	549
Acc65I	GGTACC	1 cut(s)	384
AccB1I	GGYRCC	2 cut(s)	289, 384
AccB7I	CCANNNNNTGG	1 cut(s)	833
AciI	CCGC	1 cut(s)	584
AclWI	GGATC	1 cut(s)	337
AcsI	RAATTY	1 cut(s)	349
AfaI	GTAC	6 cut(s)	305, 386, 458, 571, 601, 629
AfiI	CCNNNNNNNGG	2 cut(s)	364, 833
AflIII	ACRYGT	1 cut(s)	1056
AgeI	ACCGGT	1 cut(s)	292
AgsI	TTSAA	2 cut(s)	560, 1051
AjnI	CCWGG	3 cut(s)	112, 318, 691
AluBI	AGCT	7 cut(s)	31, 107, 124, 151, 254, 381, 900
AluI	AGCT	7 cut(s)	31, 107, 124, 151, 254, 381, 900
Alw21I	GWGCWC	2 cut(s)	90, 178
Alw26I	GTCTC	1 cut(s)	625
AlwI	GGATC	1 cut(s)	337
AoxI	GGCC	2 cut(s)	109, 432
ApeKI	GCWGC	3 cut(s)	28, 68, 662
ApoI	RAATTY	1 cut(s)	349
AsiGI	ACCGGT	1 cut(s)	292
Asp718I	GGTACC	1 cut(s)	384
AspLEI	GCGC	2 cut(s)	41, 52
AspS9I	GGNCC	2 cut(s)	110, 316
AsuC2I	CCSGG	2 cut(s)	171, 991
AsuHPI	GGTGA	3 cut(s)	494, 605, 871
AvaII	GGWCC	1 cut(s)	316
BaeI	ACNNNNGTAYC	2 cut(s)	561, 594
BanI	GGYRCC	2 cut(s)	289, 384
Bbv12I	GWGCWC	2 cut(s)	90, 178
BbvI	GCAGC	3 cut(s)	40, 80, 649
BccI	CCATC	3 cut(s)	317, 590, 644
BciT130I	CCWGG	3 cut(s)	114, 320, 693
BciVI	GTATCC	1 cut(s)	756
BclI	TGATCA	1 cut(s)	256
BcnI	CCSGG	2 cut(s)	171, 991
BcoDI	GTCTC	1 cut(s)	625
BfaI	CTAG	2 cut(s)	32, 566
BfmI	CTRYAG	1 cut(s)	180
BfoI	RGCGCY	1 cut(s)	53
BfuI	GTATCC	1 cut(s)	756
BisI	GCNGC	3 cut(s)	29, 69, 663
BlsI	GCNGC	3 cut(s)	30, 70, 664
BmcAI	AGTACT	1 cut(s)	305
Bme1390I	CCNGG	5 cut(s)	114, 171, 320, 693, 991
Bme18I	GGWCC	1 cut(s)	316
BmgT120I	GGNCC	2 cut(s)	110, 316
BmiI	GGNNCC	2 cut(s)	291, 386
BmrFI	CCNGG	5 cut(s)	114, 171, 320, 693, 991
BmsI	GCATC	4 cut(s)	50, 460, 571, 733
BpmI	CTGGAG	1 cut(s)	135
BpuMI	CCSGG	2 cut(s)	171, 991
BsaJI	CCNNGG	5 cut(s)	112, 169, 429, 538, 832
BsaWI	WCCGGW	2 cut(s)	292, 865
BsaXI	ACNNNNNCTCC	1 cut(s)	26
Bsc4I	CCNNNNNNNGG	2 cut(s)	364, 833
Bse118I	RCCGGY	1 cut(s)	292
Bse3DI	GCAATG	1 cut(s)	821
BseBI	CCWGG	3 cut(s)	114, 320, 693
BseDI	CCNNGG	5 cut(s)	112, 169, 429, 538, 832
BseGI	GGATG	1 cut(s)	328
BseLI	CCNNNNNNNGG	2 cut(s)	364, 833
BseMI	GCAATG	1 cut(s)	821
BseMII	CTCAG	2 cut(s)	249, 263
BseRI	GAGGAG	1 cut(s)	429
BseXI	GCAGC	3 cut(s)	40, 80, 649
BshFI	GGCC	2 cut(s)	111, 434
BshNI	GGYRCC	2 cut(s)	289, 384
BshTI	ACCGGT	1 cut(s)	292
BsiHKAI	GWGCWC	2 cut(s)	90, 178
BsiSI	CCGG	4 cut(s)	171, 293, 866, 990
BslI	CCNNNNNNNGG	2 cut(s)	364, 833
BsmAI	GTCTC	1 cut(s)	625
BsnI	GGCC	2 cut(s)	111, 434
Bsp1286I	GDGCHC	2 cut(s)	90, 178
Bsp143I	GATC	3 cut(s)	190, 256, 329
Bsp19I	CCATGG	1 cut(s)	832
BspACI	CCGC	1 cut(s)	584
BspANI	GGCC	2 cut(s)	111, 434
BspCNI	CTCAG	2 cut(s)	248, 264
BspHI	TCATGA	2 cut(s)	753, 921
BspLI	GGNNCC	2 cut(s)	291, 386
BspPI	GGATC	1 cut(s)	337
BspT107I	GGYRCC	2 cut(s)	289, 384
BsrDI	GCAATG	1 cut(s)	821
BsrFI	RCCGGY	1 cut(s)	292
BssAI	RCCGGY	1 cut(s)	292
BssECI	CCNNGG	5 cut(s)	112, 169, 429, 538, 832
BssMI	GATC	3 cut(s)	190, 256, 329
BssT1I	CCWWGG	3 cut(s)	429, 538, 832
Bst2UI	CCWGG	3 cut(s)	114, 320, 693
BstAPI	GCANNNNNTGC	3 cut(s)	296, 470, 1019
BstC8I	GCNNGC	1 cut(s)	109
BstDEI	CTNAG	2 cut(s)	235, 272
BstDSI	CCRYGG	1 cut(s)	832
BstF5I	GGATG	1 cut(s)	328
BstH2I	RGCGCY	1 cut(s)	53
BstHHI	GCGC	2 cut(s)	41, 52
BstKTI	GATC	3 cut(s)	193, 259, 332
BstMAI	GTCTC	1 cut(s)	625
BstMBI	GATC	3 cut(s)	190, 256, 329
BstMWI	GCNNNNNNNGC	6 cut(s)	47, 58, 296, 470, 986, 1019
BstNI	CCWGG	3 cut(s)	114, 320, 693
BstNSI	RCATGY	2 cut(s)	1017, 1060
BstSCI	CCNGG	5 cut(s)	112, 169, 318, 691, 989
BstSFI	CTRYAG	1 cut(s)	180
BstV1I	GCAGC	3 cut(s)	40, 80, 649
BstXI	CCANNNNNNTGG	1 cut(s)	1009
BsuI	GTATCC	1 cut(s)	756
BsuRI	GGCC	2 cut(s)	111, 434
BtgI	CCRYGG	1 cut(s)	832
BtsCI	GGATG	1 cut(s)	328
BtsIMutI	CAGTG	1 cut(s)	243
Cac8I	GCNNGC	1 cut(s)	109
CciI	TCATGA	2 cut(s)	753, 921
CfoI	GCGC	2 cut(s)	41, 52
Cfr10I	RCCGGY	1 cut(s)	292
Cfr13I	GGNCC	2 cut(s)	110, 316
CseI	GACGC	1 cut(s)	132
Csp6I	GTAC	6 cut(s)	304, 385, 457, 570, 600, 628
CspAI	ACCGGT	1 cut(s)	292
CviQI	GTAC	6 cut(s)	304, 385, 457, 570, 600, 628
DdeI	CTNAG	2 cut(s)	235, 272
DpnI	GATC	3 cut(s)	192, 258, 331
DpnII	GATC	3 cut(s)	190, 256, 329
Eco130I	CCWWGG	3 cut(s)	429, 538, 832
Eco147I	AGGCCT	1 cut(s)	434
Eco32I	GATATC	1 cut(s)	718
Eco47I	GGWCC	1 cut(s)	316
EcoRII	CCWGG	3 cut(s)	112, 318, 691
EcoRV	GATATC	1 cut(s)	718
EcoT14I	CCWWGG	3 cut(s)	429, 538, 832
ErhI	CCWWGG	3 cut(s)	429, 538, 832
FauI	CCCGC	1 cut(s)	577
FbaI	TGATCA	1 cut(s)	256
Fnu4HI	GCNGC	3 cut(s)	29, 69, 663
FokI	GGATG	1 cut(s)	335
Fsp4HI	GCNGC	3 cut(s)	29, 69, 663
FspBI	CTAG	2 cut(s)	32, 566
GlaI	GCGC	2 cut(s)	40, 51
GluI	GCNGC	3 cut(s)	29, 69, 663
GsuI	CTGGAG	1 cut(s)	135
HaeII	RGCGCY	1 cut(s)	53
HaeIII	GGCC	2 cut(s)	111, 434
HapII	CCGG	4 cut(s)	171, 293, 866, 990
HgaI	GACGC	1 cut(s)	132
HhaI	GCGC	2 cut(s)	41, 52
Hin6I	GCGC	2 cut(s)	39, 50
HinP1I	GCGC	2 cut(s)	39, 50
HincII	GTYRAC	1 cut(s)	370
HindII	GTYRAC	1 cut(s)	370
HindIII	AAGCTT	1 cut(s)	898
HpaII	CCGG	4 cut(s)	171, 293, 866, 990
HphI	GGTGA	3 cut(s)	494, 605, 871
Hpy166II	GTNNAC	3 cut(s)	370, 572, 727
Hpy188I	TCNGA	3 cut(s)	136, 273, 735
Hpy188III	TCNNGA	5 cut(s)	314, 493, 754, 922, 1051
Hpy8I	GTNNAC	3 cut(s)	370, 572, 727
Hpy99I	CGWCG	1 cut(s)	799
HpyAV	CCTTC	5 cut(s)	215, 259, 404, 523, 554
HpyCH4V	TGCA	5 cut(s)	28, 473, 710, 893, 1022
HpyF10VI	GCNNNNNNNGC	6 cut(s)	47, 58, 296, 470, 986, 1019
HpyF3I	CTNAG	2 cut(s)	235, 272
HspAI	GCGC	2 cut(s)	39, 50
KpnI	GGTACC	1 cut(s)	388
Ksp22I	TGATCA	1 cut(s)	256
Kzo9I	GATC	3 cut(s)	190, 256, 329
LmnI	GCTCC	2 cut(s)	156, 181
Lsp1109I	GCAGC	3 cut(s)	40, 80, 649
LweI	GCATC	4 cut(s)	50, 460, 571, 733
MaeI	CTAG	2 cut(s)	32, 566
MaeIII	GTNAC	1 cut(s)	144
MalI	GATC	3 cut(s)	192, 258, 331
MboI	GATC	3 cut(s)	190, 256, 329
MboII	GAAGA	1 cut(s)	123
MhlI	GDGCHC	2 cut(s)	90, 178
MluCI	AATT	1 cut(s)	349
MnlI	CCTC	6 cut(s)	166, 267, 320, 407, 694, 811
MseI	TTAA	4 cut(s)	63, 513, 609, 1026
MslI	CAYNNNNRTG	4 cut(s)	446, 752, 777, 1007
MspI	CCGG	4 cut(s)	171, 293, 866, 990
MspR9I	CCNGG	5 cut(s)	114, 171, 320, 693, 991
MvaI	CCWGG	3 cut(s)	114, 320, 693
MwoI	GCNNNNNNNGC	6 cut(s)	47, 58, 296, 470, 986, 1019
NciI	CCSGG	2 cut(s)	171, 991
NcoI	CCATGG	1 cut(s)	832
NdeII	GATC	3 cut(s)	190, 256, 329
NlaIV	GGNNCC	2 cut(s)	291, 386
NmuCI	GTSAC	1 cut(s)	144
NspI	RCATGY	2 cut(s)	1017, 1060
PagI	TCATGA	2 cut(s)	753, 921
PceI	AGGCCT	1 cut(s)	434
PciI	ACATGT	1 cut(s)	1056
PflFI	GACNNNGTC	1 cut(s)	365
PflMI	CCANNNNNTGG	1 cut(s)	833
PinAI	ACCGGT	1 cut(s)	292
PkrI	GCNGC	3 cut(s)	30, 70, 664
PscI	ACATGT	1 cut(s)	1056
PsiI	TTATAA	1 cut(s)	549
Psp6I	CCWGG	3 cut(s)	112, 318, 691
PspGI	CCWGG	3 cut(s)	112, 318, 691
PspN4I	GGNNCC	2 cut(s)	291, 386
PspPI	GGNCC	2 cut(s)	110, 316
PsyI	GACNNNGTC	1 cut(s)	365
RsaI	GTAC	6 cut(s)	305, 386, 458, 571, 601, 629
RsaNI	GTAC	6 cut(s)	304, 385, 457, 570, 600, 628
RseI	CAYNNNNRTG	4 cut(s)	446, 752, 777, 1007
SaqAI	TTAA	4 cut(s)	63, 513, 609, 1026
SatI	GCNGC	3 cut(s)	29, 69, 663
Sau3AI	GATC	3 cut(s)	190, 256, 329
Sau96I	GGNCC	2 cut(s)	110, 316
ScaI	AGTACT	1 cut(s)	305
ScrFI	CCNGG	5 cut(s)	114, 171, 320, 693, 991
SduI	GDGCHC	2 cut(s)	90, 178
SfaNI	GCATC	4 cut(s)	50, 460, 571, 733
SfcI	CTRYAG	1 cut(s)	180
SinI	GGWCC	1 cut(s)	316
SmiMI	CAYNNNNRTG	4 cut(s)	446, 752, 777, 1007
Sse9I	AATT	1 cut(s)	349
SseBI	AGGCCT	1 cut(s)	434
SsiI	CCGC	1 cut(s)	584
SspMI	CTAG	2 cut(s)	32, 566
StuI	AGGCCT	1 cut(s)	434
StyD4I	CCNGG	5 cut(s)	112, 169, 318, 691, 989
StyI	CCWWGG	3 cut(s)	429, 538, 832
TaqI	TCGA	3 cut(s)	90, 794, 1006
TasI	AATT	1 cut(s)	349
TatI	WGTACW	2 cut(s)	303, 456
Tru1I	TTAA	4 cut(s)	63, 513, 609, 1026
Tru9I	TTAA	4 cut(s)	63, 513, 609, 1026
TscAI	CASTG	1 cut(s)	250
TseFI	GTSAC	1 cut(s)	144
TseI	GCWGC	3 cut(s)	28, 68, 662
Tsp45I	GTSAC	1 cut(s)	144
TspRI	CASTG	1 cut(s)	250
Tth111I	GACNNNGTC	1 cut(s)	365
Van91I	CCANNNNNTGG	1 cut(s)	833
VpaK11BI	GGWCC	1 cut(s)	316
XapI	RAATTY	1 cut(s)	349
XceI	RCATGY	2 cut(s)	1017, 1060
XspI	CTAG	2 cut(s)	32, 566
ZrmI	AGTACT	1 cut(s)	305

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.