Rh7CG090000

caffeic acid

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0004266
Physical Location & Seq
Reverse (-)
6768541 .. 6769002
462 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG090000.1

Sequence Viewer

Length: 366 bp
ATGTTCATTAGTACTATTATCTTCTTGGCCGTGGTTTCAACTAACACAGGGTTTTATAAACAGTGGTTACTACACCTTTTCGATGACAAACATTGCTTGATGATACTAAAGAACTGCTATGAGGCCTTGCCAGACCATGGGAAAATGATGGTAGTAAATTTGGTTATACCAGAAGCCCATGAAACTAGTCTTTTTGCTAAAAGCTTGTTTCAGTTTGATATGTTCCTGATGAACACCACTACAAGTGGAAGGGAGAGGACAGAGAAAGAATTCGAAAGTCTGGCAAAACAAGCAGGGTTTTACACCATTCGAGTGGCATGTTCTGCATTTAATTTTTCAGTGGTGGAGCTTTTCAAGAGCATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dimerisation Methyltransf_2

Protein Analysis

121

Amino Acids

13.95

Weight (kDa)

6.4

Isoelectric Point (pI)

25.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Methyltransf_2 PF00891 21 - 100 1.9e-18 O-methyltransferase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 57
AccB7I CCANNNNNTGG 1 cut(s) 137
AcoI YGGCCR 1 cut(s) 27
AcsI RAATTY 2 cut(s) 157, 269
AfaI GTAC 1 cut(s) 13
AfiI CCNNNNNNNGG 1 cut(s) 137
AgsI TTSAA 2 cut(s) 39, 355
AhlI ACTAGT 1 cut(s) 185
AluBI AGCT 2 cut(s) 204, 349
AluI AGCT 2 cut(s) 204, 349
AoxI GGCC 2 cut(s) 27, 123
ApoI RAATTY 2 cut(s) 157, 269
Asp700I GAANNNNTTC 1 cut(s) 269
AsuII TTCGAA 1 cut(s) 273
BccI CCATC 1 cut(s) 142
BceAI ACGGC 1 cut(s) 14
BcuI ACTAGT 1 cut(s) 185
BfaI CTAG 1 cut(s) 186
BmcAI AGTACT 1 cut(s) 13
Bpu14I TTCGAA 1 cut(s) 273
BsaJI CCNNGG 2 cut(s) 30, 136
Bsc4I CCNNNNNNNGG 1 cut(s) 137
Bse3DI GCAATG 1 cut(s) 91
BseDI CCNNGG 2 cut(s) 30, 136
BseLI CCNNNNNNNGG 1 cut(s) 137
BseMI GCAATG 1 cut(s) 91
BshFI GGCC 2 cut(s) 29, 125
BslI CCNNNNNNNGG 1 cut(s) 137
BsnI GGCC 2 cut(s) 29, 125
Bsp119I TTCGAA 1 cut(s) 273
Bsp19I CCATGG 1 cut(s) 136
BspANI GGCC 2 cut(s) 29, 125
BspT104I TTCGAA 1 cut(s) 273
BsrDI GCAATG 1 cut(s) 91
BssECI CCNNGG 2 cut(s) 30, 136
BssT1I CCWWGG 1 cut(s) 136
Bst4CI ACNGT 1 cut(s) 63
BstAPI GCANNNNNTGC 1 cut(s) 323
BstBI TTCGAA 1 cut(s) 273
BstDSI CCRYGG 2 cut(s) 30, 136
BstMWI GCNNNNNNNGC 2 cut(s) 290, 323
BstNSI RCATGY 2 cut(s) 321, 364
BstXI CCANNNNNNTGG 1 cut(s) 313
BsuRI GGCC 2 cut(s) 29, 125
BtgI CCRYGG 2 cut(s) 30, 136
BtsIMutI CAGTG 2 cut(s) 68, 345
Csp6I GTAC 1 cut(s) 12
CviAII CATG 4 cut(s) 137, 179, 318, 361
CviJI RGCY 5 cut(s) 29, 125, 176, 204, 349
CviKI_1 RGCY 5 cut(s) 29, 125, 176, 204, 349
CviQI GTAC 1 cut(s) 12
EaeI YGGCCR 1 cut(s) 27
Eco130I CCWWGG 1 cut(s) 136
Eco147I AGGCCT 1 cut(s) 125
EcoRI GAATTC 1 cut(s) 269
EcoT14I CCWWGG 1 cut(s) 136
ErhI CCWWGG 1 cut(s) 136
FaeI CATG 4 cut(s) 140, 182, 321, 364
FaiI YATR 8 cut(s) 57, 120, 138, 167, 180, 221, 319, 362
FatI CATG 4 cut(s) 136, 178, 317, 360
FspBI CTAG 1 cut(s) 186
HaeIII GGCC 2 cut(s) 29, 125
Hin1II CATG 4 cut(s) 140, 182, 321, 364
HindIII AAGCTT 1 cut(s) 202
Hpy188III TCNNGA 2 cut(s) 226, 355
HpyAV CCTTC 1 cut(s) 243
HpyCH4III ACNGT 1 cut(s) 63
HpyCH4V TGCA 1 cut(s) 326
HpyF10VI GCNNNNNNNGC 2 cut(s) 290, 323
Hsp92II CATG 4 cut(s) 140, 182, 321, 364
LmnI GCTCC 1 cut(s) 346
LpnPI CCDG 6 cut(s) 33, 144, 183, 239, 266, 279
MaeI CTAG 1 cut(s) 186
MaeIII GTNAC 1 cut(s) 66
MboII GAAGA 1 cut(s) 13
MluCI AATT 3 cut(s) 157, 269, 331
MnlI CCTC 2 cut(s) 115, 249
MroXI GAANNNNTTC 1 cut(s) 269
MseI TTAA 1 cut(s) 330
MslI CAYNNNNRTG 1 cut(s) 311
MwoI GCNNNNNNNGC 2 cut(s) 290, 323
NcoI CCATGG 1 cut(s) 136
NlaIII CATG 4 cut(s) 140, 182, 321, 364
NspI RCATGY 2 cut(s) 321, 364
NspV TTCGAA 1 cut(s) 273
PceI AGGCCT 1 cut(s) 125
PdmI GAANNNNTTC 1 cut(s) 269
PflMI CCANNNNNTGG 1 cut(s) 137
PsiI TTATAA 1 cut(s) 57
RsaI GTAC 1 cut(s) 13
RsaNI GTAC 1 cut(s) 12
RseI CAYNNNNRTG 1 cut(s) 311
SaqAI TTAA 1 cut(s) 330
ScaI AGTACT 1 cut(s) 13
SetI ASST 3 cut(s) 78, 206, 351
SfuI TTCGAA 1 cut(s) 273
SmiMI CAYNNNNRTG 1 cut(s) 311
SpeI ACTAGT 1 cut(s) 185
Sse9I AATT 3 cut(s) 157, 269, 331
SseBI AGGCCT 1 cut(s) 125
SspMI CTAG 1 cut(s) 186
StuI AGGCCT 1 cut(s) 125
StyI CCWWGG 1 cut(s) 136
TaaI ACNGT 1 cut(s) 63
TaqI TCGA 3 cut(s) 81, 273, 310
TasI AATT 3 cut(s) 157, 269, 331
TatI WGTACW 1 cut(s) 11
Tru1I TTAA 1 cut(s) 330
Tru9I TTAA 1 cut(s) 330
TscAI CASTG 2 cut(s) 68, 345
TspDTI ATGAA 2 cut(s) 195, 245
TspRI CASTG 2 cut(s) 68, 345
Van91I CCANNNNNTGG 1 cut(s) 137
XapI RAATTY 2 cut(s) 157, 269
XceI RCATGY 2 cut(s) 321, 364
XmnI GAANNNNTTC 1 cut(s) 269
XspI CTAG 1 cut(s) 186
ZrmI AGTACT 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.