Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005650.1

Orthogroup ID

OG0002354

Physical Location & Seq

Genomic Coordinates Reverse (-)

41341 .. 42037

Gene Structure 697 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005650.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 588 bp

atgcctattgaatctccggtcgagtctccaactacgtcctcacctgtcaggttgacaaatcatgaagaaggatcagattcagagggttgcagggttggtacagggttgcaatcttcggatatttctgcaagaaaacatgctgatccagctcttgtggacttgctcaaagtctctttcacacaatcaaatttctccatggcattcccctatatttctacatcggagaatgatgctgtggaaagttctttagtgtcagggatgtcagagatttgtgggcagaattttggattcaataatgtttgtttctcggagtcatgctctatgtggggtgatgatgttcaaaagctttcagacctgcattcggtccatgattattttcttttgaggatggagaagagaccaaatggggaagcagatttggtggtgttctgccacaaaggatctgattctaaaaaggaattagaacacccacattcagagagtaaaattttctctgagatggttagttttgtggatcagtctggggcaaaatatgcagttctatatgtctcagaccccattaaatcaatccaatatccttctcattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

195

Amino Acids

21.45

Weight (kDa)

4.9

Isoelectric Point (pI)

53.91

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002354)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G55546 AT3G13410
fragaria_vesca	FvH4_3g45990 FvH4_3g45990 FvH4_3g45990 FvH4_3g45990 FvH4_3g45990
malus_domestica	MD03G1001400.v1.1 MD11G1000600.v1.1
prunus_persica	Prupe.6G000900_v2.0.a1 Prupe.6G000900_v2.0.a1
pyrus_communis	pycom03g00120 pycom11g00090
rosa_chinensis	RchiOBHm_Chr4g0398051 RchiOBHm_Chr5g0084101 RchiOBHm_Chr7g0192441
rosa_laevigata	RLG00000004367 RLG00000008074 RLG00000008858 RLG00000014509 RLG00000016748 RLG00000018971 RLG00000028663 RLG00000030057 RLG00000035035 RLG00000037082
rosa_multiflora	Rmu_sc0005650.1_g000007 Rmu_ssc0000372.1_g000093
rosa_roxburghii	Rroxscaffold_1G00000540 Rroxscaffold_7G00215590
rosa_rugosa	Rorug05G0489000 Rorug05G0489100
rosa_samantha	Rh3DG104400 Rh5BG567300 Rh5CG359700 Rh5CG589100 Rh5DG290500 Rh5DG575500 Rh7AG125500 Rh7CG129500
rosa_wichuraiana	Rw5G050390 Rw7G010810

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	363
AclWI	GGATC	4 cut(s)	79, 137, 448, 522
AcsI	RAATTY	3 cut(s)	187, 280, 486
AfaI	GTAC	1 cut(s)	100
AfiI	CCNNNNNNNGG	1 cut(s)	361
AgsI	TTSAA	3 cut(s)	11, 292, 341
AluBI	AGCT	2 cut(s)	149, 346
AluI	AGCT	2 cut(s)	149, 346
Alw26I	GTCTC	4 cut(s)	30, 175, 391, 553
AlwI	GGATC	4 cut(s)	79, 137, 448, 522
ApoI	RAATTY	3 cut(s)	187, 280, 486
AspS9I	GGNCC	1 cut(s)	364
AsuHPI	GGTGA	2 cut(s)	33, 341
AvaII	GGWCC	1 cut(s)	364
BccI	CCATC	2 cut(s)	382, 493
BcoDI	GTCTC	4 cut(s)	30, 175, 391, 553
BfuAI	ACCTGC	1 cut(s)	363
Bme18I	GGWCC	1 cut(s)	364
BmgT120I	GGNCC	1 cut(s)	364
BmsI	GCATC	1 cut(s)	220
BplI	GAGNNNNNCTC	2 cut(s)	302, 334
BsaI	GGTCTC	1 cut(s)	391
BsaJI	CCNNGG	1 cut(s)	195
BsaWI	WCCGGW	1 cut(s)	16
Bsc4I	CCNNNNNNNGG	1 cut(s)	361
BseDI	CCNNGG	1 cut(s)	195
BseGI	GGATG	2 cut(s)	264, 393
BseLI	CCNNNNNNNGG	1 cut(s)	361
BseMII	CTCAG	2 cut(s)	486, 564
Bsh1285I	CGRYCG	1 cut(s)	21
BsiEI	CGRYCG	1 cut(s)	21
BsiSI	CCGG	1 cut(s)	17
BslI	CCNNNNNNNGG	1 cut(s)	361
BsmAI	GTCTC	4 cut(s)	30, 175, 391, 553
BsmI	GAATGC	2 cut(s)	200, 358
Bso31I	GGTCTC	1 cut(s)	391
Bsp143I	GATC	4 cut(s)	71, 142, 440, 514
Bsp19I	CCATGG	1 cut(s)	195
BspCNI	CTCAG	2 cut(s)	487, 563
BspHI	TCATGA	1 cut(s)	61
BspMI	ACCTGC	1 cut(s)	363
BspPI	GGATC	4 cut(s)	79, 137, 448, 522
BspTNI	GGTCTC	1 cut(s)	391
BssECI	CCNNGG	1 cut(s)	195
BssMI	GATC	4 cut(s)	71, 142, 440, 514
BssT1I	CCWWGG	1 cut(s)	195
Bst6I	CTCTTC	1 cut(s)	389
BstAPI	GCANNNNNTGC	1 cut(s)	533
BstDEI	CTNAG	2 cut(s)	495, 550
BstDSI	CCRYGG	1 cut(s)	195
BstF5I	GGATG	2 cut(s)	264, 393
BstKTI	GATC	4 cut(s)	74, 145, 443, 517
BstMAI	GTCTC	4 cut(s)	30, 175, 391, 553
BstMBI	GATC	4 cut(s)	71, 142, 440, 514
BstMCI	CGRYCG	1 cut(s)	21
BstMWI	GCNNNNNNNGC	2 cut(s)	146, 533
BstNSI	RCATGY	1 cut(s)	140
BstX2I	RGATCY	1 cut(s)	440
BstYI	RGATCY	1 cut(s)	440
BtgI	CCRYGG	1 cut(s)	195
BtsCI	GGATG	2 cut(s)	264, 393
BveI	ACCTGC	1 cut(s)	363
CciI	TCATGA	1 cut(s)	61
Cfr13I	GGNCC	1 cut(s)	364
Csp6I	GTAC	1 cut(s)	99
CviAII	CATG	5 cut(s)	62, 137, 196, 315, 368
CviJI	RGCY	2 cut(s)	149, 346
CviKI_1	RGCY	2 cut(s)	149, 346
CviQI	GTAC	1 cut(s)	99
DdeI	CTNAG	2 cut(s)	495, 550
DpnI	GATC	4 cut(s)	73, 144, 442, 516
DpnII	GATC	4 cut(s)	71, 142, 440, 514
Eam1104I	CTCTTC	1 cut(s)	389
EarI	CTCTTC	1 cut(s)	389
Eco130I	CCWWGG	1 cut(s)	195
Eco31I	GGTCTC	1 cut(s)	391
Eco47I	GGWCC	1 cut(s)	364
EcoT14I	CCWWGG	1 cut(s)	195
ErhI	CCWWGG	1 cut(s)	195
FaeI	CATG	5 cut(s)	65, 140, 199, 318, 371
FatI	CATG	5 cut(s)	61, 136, 195, 314, 367
FokI	GGATG	2 cut(s)	271, 400
HapII	CCGG	1 cut(s)	17
Hin1II	CATG	5 cut(s)	65, 140, 199, 318, 371
HincII	GTYRAC	1 cut(s)	54
HindII	GTYRAC	1 cut(s)	54
HindIII	AAGCTT	1 cut(s)	344
HinfI	GANTC	6 cut(s)	11, 23, 77, 288, 311, 446
HpaII	CCGG	1 cut(s)	17
HphI	GGTGA	2 cut(s)	33, 341
Hpy166II	GTNNAC	2 cut(s)	54, 157
Hpy188III	TCNNGA	1 cut(s)	62
Hpy8I	GTNNAC	2 cut(s)	54, 157
HpyAV	CCTTC	2 cut(s)	62, 588
HpyCH4IV	ACGT	1 cut(s)	35
HpyCH4V	TGCA	5 cut(s)	90, 109, 128, 358, 536
HpyF10VI	GCNNNNNNNGC	2 cut(s)	146, 533
HpyF3I	CTNAG	2 cut(s)	495, 550
HpySE526I	ACGT	1 cut(s)	35
Hsp92II	CATG	5 cut(s)	65, 140, 199, 318, 371
Kzo9I	GATC	4 cut(s)	71, 142, 440, 514
LpnPI	CCDG	9 cut(s)	30, 34, 57, 76, 87, 159, 240, 368, 507
LweI	GCATC	1 cut(s)	220
MaeII	ACGT	1 cut(s)	35
MalI	GATC	4 cut(s)	73, 144, 442, 516
MboI	GATC	4 cut(s)	71, 142, 440, 514
MboII	GAAGA	3 cut(s)	77, 105, 406
MflI	RGATCY	1 cut(s)	440
MluCI	AATT	4 cut(s)	187, 280, 458, 486
MlyI	GAGTC	2 cut(s)	32, 320
MmeI	TCCRAC	1 cut(s)	53
MnlI	CCTC	3 cut(s)	49, 76, 378
MseI	TTAA	1 cut(s)	561
MspI	CCGG	1 cut(s)	17
Mva1269I	GAATGC	2 cut(s)	200, 358
MwoI	GCNNNNNNNGC	2 cut(s)	146, 533
NcoI	CCATGG	1 cut(s)	195
NdeII	GATC	4 cut(s)	71, 142, 440, 514
NlaIII	CATG	5 cut(s)	65, 140, 199, 318, 371
NspI	RCATGY	1 cut(s)	140
PagI	TCATGA	1 cut(s)	61
PctI	GAATGC	2 cut(s)	200, 358
PfeI	GAWTC	4 cut(s)	11, 77, 288, 446
PleI	GAGTC	2 cut(s)	31, 319
PpsI	GAGTC	2 cut(s)	31, 319
PspPI	GGNCC	1 cut(s)	364
PsuI	RGATCY	1 cut(s)	440
RsaI	GTAC	1 cut(s)	100
RsaNI	GTAC	1 cut(s)	99
SaqAI	TTAA	1 cut(s)	561
Sau3AI	GATC	4 cut(s)	71, 142, 440, 514
Sau96I	GGNCC	1 cut(s)	364
SchI	GAGTC	2 cut(s)	32, 320
SetI	ASST	6 cut(s)	38, 46, 53, 151, 348, 357
SfaNI	GCATC	1 cut(s)	220
SinI	GGWCC	1 cut(s)	364
Sse9I	AATT	4 cut(s)	187, 280, 458, 486
StyI	CCWWGG	1 cut(s)	195
TaiI	ACGT	1 cut(s)	38
TaqI	TCGA	1 cut(s)	21
TaqII	GACCGA	1 cut(s)	352
TasI	AATT	4 cut(s)	187, 280, 458, 486
TfiI	GAWTC	4 cut(s)	11, 77, 288, 446
Tru1I	TTAA	1 cut(s)	561
Tru9I	TTAA	1 cut(s)	561
TspDTI	ATGAA	1 cut(s)	78
VpaK11BI	GGWCC	1 cut(s)	364
XapI	RAATTY	3 cut(s)	187, 280, 486
XceI	RCATGY	1 cut(s)	140

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.