Rh7CG129500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
10201277 .. 10201660
384 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG129500.1

Sequence Viewer

Length: 384 bp
ATGGCATTCCCCTGTATTTCTGCATCAGAGAAGGATGCTATGGAAAGTTCTTTAGTGTCAGAGATTTGCGGGCAGAATTTTGGATTCAGTAATGTTTGTTTCACGGAGGCATGCTCTATGTGGGGTGATGATCTTCAAAAGCTTTCAGACCTGCATTCGGTCCATGATTATCTTCTTTCGAGGATGGAGAAGAGACCAAATGGGGAAGCAGATTTGGTGGTGTTCTGCCACAAAGGATCTGATTCTAAAAAGGAACTAGAACCCCCACATTCAGAGAGTAAAAATTTCTCTGAGATGGTTAGTTTTGTGGATCAGTCTGGGGCAAAATATGCAGTTCTATATGTTTCAGACCCCATTAAATCAATCCAATACCCTTCTCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

127

Amino Acids

14.13

Weight (kDa)

4.95

Isoelectric Point (pI)

43.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 159
AciI CCGC 1 cut(s) 69
AclWI GGATC 2 cut(s) 244, 318
AcsI RAATTY 2 cut(s) 76, 283
AfiI CCNNNNNNNGG 1 cut(s) 157
AgsI TTSAA 1 cut(s) 137
AluBI AGCT 1 cut(s) 142
AluI AGCT 1 cut(s) 142
Alw26I GTCTC 1 cut(s) 187
AlwI GGATC 2 cut(s) 244, 318
ApoI RAATTY 2 cut(s) 76, 283
AspS9I GGNCC 1 cut(s) 160
AsuHPI GGTGA 1 cut(s) 137
AvaII GGWCC 1 cut(s) 160
BccI CCATC 2 cut(s) 178, 289
BcoDI GTCTC 1 cut(s) 187
BfaI CTAG 1 cut(s) 257
BfuAI ACCTGC 1 cut(s) 159
Bme18I GGWCC 1 cut(s) 160
BmgT120I GGNCC 1 cut(s) 160
BmsI GCATC 2 cut(s) 25, 32
BplI GAGNNNNNCTC 2 cut(s) 98, 130
BsaI GGTCTC 1 cut(s) 187
Bsc4I CCNNNNNNNGG 1 cut(s) 157
BseGI GGATG 2 cut(s) 40, 189
BseLI CCNNNNNNNGG 1 cut(s) 157
BseMII CTCAG 1 cut(s) 282
BslI CCNNNNNNNGG 1 cut(s) 157
BsmAI GTCTC 1 cut(s) 187
BsmI GAATGC 2 cut(s) 5, 154
Bso31I GGTCTC 1 cut(s) 187
Bsp143I GATC 3 cut(s) 130, 236, 310
BspACI CCGC 1 cut(s) 69
BspCNI CTCAG 1 cut(s) 283
BspMI ACCTGC 1 cut(s) 159
BspPI GGATC 2 cut(s) 244, 318
BspTNI GGTCTC 1 cut(s) 187
BssMI GATC 3 cut(s) 130, 236, 310
Bst6I CTCTTC 1 cut(s) 185
BstAPI GCANNNNNTGC 1 cut(s) 329
BstC8I GCNNGC 2 cut(s) 71, 112
BstDEI CTNAG 1 cut(s) 291
BstF5I GGATG 2 cut(s) 40, 189
BstKTI GATC 3 cut(s) 133, 239, 313
BstMAI GTCTC 1 cut(s) 187
BstMBI GATC 3 cut(s) 130, 236, 310
BstMWI GCNNNNNNNGC 1 cut(s) 329
BstNSI RCATGY 1 cut(s) 114
BstX2I RGATCY 1 cut(s) 236
BstYI RGATCY 1 cut(s) 236
BtsCI GGATG 2 cut(s) 40, 189
BveI ACCTGC 1 cut(s) 159
Cac8I GCNNGC 2 cut(s) 71, 112
Cfr13I GGNCC 1 cut(s) 160
CviAII CATG 2 cut(s) 111, 164
CviJI RGCY 1 cut(s) 142
CviKI_1 RGCY 1 cut(s) 142
DdeI CTNAG 1 cut(s) 291
DpnI GATC 3 cut(s) 132, 238, 312
DpnII GATC 3 cut(s) 130, 236, 310
Eam1104I CTCTTC 1 cut(s) 185
EarI CTCTTC 1 cut(s) 185
Eco31I GGTCTC 1 cut(s) 187
Eco47I GGWCC 1 cut(s) 160
FaeI CATG 2 cut(s) 114, 167
FaiI YATR 7 cut(s) 41, 112, 119, 165, 330, 340, 342
FatI CATG 2 cut(s) 110, 163
FauI CCCGC 1 cut(s) 62
FokI GGATG 2 cut(s) 47, 196
FspBI CTAG 1 cut(s) 257
Hin1II CATG 2 cut(s) 114, 167
HindIII AAGCTT 1 cut(s) 140
HinfI GANTC 2 cut(s) 84, 242
HphI GGTGA 1 cut(s) 137
Hpy188I TCNGA 7 cut(s) 28, 61, 148, 241, 274, 292, 349
HpyAV CCTTC 2 cut(s) 25, 384
HpyCH4V TGCA 3 cut(s) 23, 154, 332
HpyF10VI GCNNNNNNNGC 1 cut(s) 329
HpyF3I CTNAG 1 cut(s) 291
Hsp92II CATG 2 cut(s) 114, 167
Kzo9I GATC 3 cut(s) 130, 236, 310
LpnPI CCDG 3 cut(s) 25, 164, 303
LweI GCATC 2 cut(s) 25, 32
MaeI CTAG 1 cut(s) 257
MalI GATC 3 cut(s) 132, 238, 312
MboI GATC 3 cut(s) 130, 236, 310
MboII GAAGA 3 cut(s) 125, 164, 202
MflI RGATCY 1 cut(s) 236
MluCI AATT 2 cut(s) 76, 283
MnlI CCTC 2 cut(s) 100, 174
MseI TTAA 1 cut(s) 357
Mva1269I GAATGC 2 cut(s) 5, 154
MwoI GCNNNNNNNGC 1 cut(s) 329
NdeII GATC 3 cut(s) 130, 236, 310
NlaIII CATG 2 cut(s) 114, 167
NspI RCATGY 1 cut(s) 114
PaeI GCATGC 1 cut(s) 114
PctI GAATGC 2 cut(s) 5, 154
PfeI GAWTC 2 cut(s) 84, 242
PspPI GGNCC 1 cut(s) 160
PsuI RGATCY 1 cut(s) 236
SaqAI TTAA 1 cut(s) 357
Sau3AI GATC 3 cut(s) 130, 236, 310
Sau96I GGNCC 1 cut(s) 160
SetI ASST 2 cut(s) 144, 153
SfaNI GCATC 2 cut(s) 25, 32
SgeI CNNG 9 cut(s) 24, 82, 115, 123, 163, 176, 192, 269, 330
SinI GGWCC 1 cut(s) 160
SphI GCATGC 1 cut(s) 114
Sse9I AATT 2 cut(s) 76, 283
SsiI CCGC 1 cut(s) 69
SspMI CTAG 1 cut(s) 257
TaqI TCGA 1 cut(s) 179
TaqII GACCGA 1 cut(s) 148
TasI AATT 2 cut(s) 76, 283
TfiI GAWTC 2 cut(s) 84, 242
Tru1I TTAA 1 cut(s) 357
Tru9I TTAA 1 cut(s) 357
TspGWI ACGGA 1 cut(s) 119
VpaK11BI GGWCC 1 cut(s) 160
XapI RAATTY 2 cut(s) 76, 283
XceI RCATGY 1 cut(s) 114
XspI CTAG 1 cut(s) 257
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.