Rmu_sc0006282.1_g000005

TBC1 domain family member

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006282.1
Physical Location & Seq
Forward (+)
27815 .. 28524
710 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006282.1_g000005.1.cds

Sequence Viewer

Length: 303 bp
atgtttcatgtggctttggcaatctttaagatgaaggaacaggagttgcttctaacccatcatgttggcgatgtaattaatattctgcagaaaaccactcatcatctatttgatcctgatgagctattgacggtagcatttgatcagataggttcgtttacaaccaacactatatcaaagcaaaggaaaaaacaagaaccggcagtgatgaaggagcttgatcagagagttcaacggttaaattccctgaaattggaagagaataacataccgagtcaaaatgcagaatgtcactcaacctag

Protein Analysis

100

Amino Acids

11.52

Weight (kDa)

6.28

Isoelectric Point (pI)

51.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 107
AcsI RAATTY 1 cut(s) 241
AfiI CCNNNNNNNGG 1 cut(s) 253
AgsI TTSAA 1 cut(s) 233
AluBI AGCT 2 cut(s) 124, 217
AluI AGCT 2 cut(s) 124, 217
AlwI GGATC 1 cut(s) 107
ApoI RAATTY 1 cut(s) 241
AseI ATTAAT 1 cut(s) 78
BccI CCATC 1 cut(s) 66
BclI TGATCA 2 cut(s) 142, 220
BfaI CTAG 1 cut(s) 301
BfmI CTRYAG 1 cut(s) 86
Bsc4I CCNNNNNNNGG 1 cut(s) 253
Bse118I RCCGGY 1 cut(s) 199
BseLI CCNNNNNNNGG 1 cut(s) 253
BsiSI CCGG 1 cut(s) 200
BslI CCNNNNNNNGG 1 cut(s) 253
Bsp143I GATC 3 cut(s) 112, 142, 220
BspMAI CTGCAG 1 cut(s) 90
BspPI GGATC 1 cut(s) 107
BsrFI RCCGGY 1 cut(s) 199
BssAI RCCGGY 1 cut(s) 199
BssMI GATC 3 cut(s) 112, 142, 220
Bst4CI ACNGT 2 cut(s) 133, 237
Bst6I CTCTTC 1 cut(s) 252
BstKTI GATC 3 cut(s) 115, 145, 223
BstMBI GATC 3 cut(s) 112, 142, 220
BstSFI CTRYAG 1 cut(s) 86
BstXI CCANNNNNNTGG 1 cut(s) 65
BtgZI GCGATG 1 cut(s) 84
BtsI GCAGTG 1 cut(s) 210
BtsIMutI CAGTG 1 cut(s) 210
Cfr10I RCCGGY 1 cut(s) 199
CviAII CATG 2 cut(s) 8, 62
CviJI RGCY 3 cut(s) 14, 124, 217
CviKI_1 RGCY 3 cut(s) 14, 124, 217
DpnI GATC 3 cut(s) 114, 144, 222
DpnII GATC 3 cut(s) 112, 142, 220
Eam1104I CTCTTC 1 cut(s) 252
EarI CTCTTC 1 cut(s) 252
FaeI CATG 2 cut(s) 11, 65
FaiI YATR 4 cut(s) 9, 63, 173, 269
FatI CATG 2 cut(s) 7, 61
FbaI TGATCA 2 cut(s) 142, 220
FspBI CTAG 1 cut(s) 301
HapII CCGG 1 cut(s) 200
Hin1II CATG 2 cut(s) 11, 65
HinfI GANTC 1 cut(s) 274
HpaII CCGG 1 cut(s) 200
Hpy166II GTNNAC 1 cut(s) 159
Hpy188I TCNGA 2 cut(s) 147, 225
Hpy188III TCNNGA 1 cut(s) 116
Hpy8I GTNNAC 1 cut(s) 159
HpyAV CCTTC 2 cut(s) 28, 205
HpyCH4III ACNGT 2 cut(s) 133, 237
HpyCH4V TGCA 2 cut(s) 88, 284
Hsp92II CATG 2 cut(s) 11, 65
Ksp22I TGATCA 2 cut(s) 142, 220
Kzo9I GATC 3 cut(s) 112, 142, 220
LmnI GCTCC 1 cut(s) 214
LpnPI CCDG 4 cut(s) 26, 129, 213, 260
MaeI CTAG 1 cut(s) 301
MaeIII GTNAC 1 cut(s) 290
MalI GATC 3 cut(s) 114, 144, 222
MboI GATC 3 cut(s) 112, 142, 220
MboII GAAGA 1 cut(s) 269
MluCI AATT 3 cut(s) 75, 241, 251
MlyI GAGTC 1 cut(s) 283
MseI TTAA 3 cut(s) 27, 78, 239
MspI CCGG 1 cut(s) 200
NdeII GATC 3 cut(s) 112, 142, 220
NlaIII CATG 2 cut(s) 11, 65
NmuCI GTSAC 1 cut(s) 290
PleI GAGTC 1 cut(s) 282
PpsI GAGTC 1 cut(s) 282
PshBI ATTAAT 1 cut(s) 78
PstI CTGCAG 1 cut(s) 90
SaqAI TTAA 3 cut(s) 27, 78, 239
Sau3AI GATC 3 cut(s) 112, 142, 220
SchI GAGTC 1 cut(s) 283
SetI ASST 4 cut(s) 126, 154, 219, 302
SfcI CTRYAG 1 cut(s) 86
SgeI CNNG 9 cut(s) 20, 53, 74, 128, 206, 212, 230, 259, 285
Sse9I AATT 3 cut(s) 75, 241, 251
SspI AATATT 1 cut(s) 82
SspMI CTAG 1 cut(s) 301
TaaI ACNGT 2 cut(s) 133, 237
TasI AATT 3 cut(s) 75, 241, 251
Tru1I TTAA 3 cut(s) 27, 78, 239
Tru9I TTAA 3 cut(s) 27, 78, 239
TscAI CASTG 1 cut(s) 210
TseFI GTSAC 1 cut(s) 290
Tsp45I GTSAC 1 cut(s) 290
TspDTI ATGAA 2 cut(s) 47, 224
TspRI CASTG 1 cut(s) 210
VspI ATTAAT 1 cut(s) 78
XapI RAATTY 1 cut(s) 241
XspI CTAG 1 cut(s) 301
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.