Rmu_sc0006711.1_g000026

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006711.1
OG0007526
Physical Location & Seq
Reverse (-)
75942 .. 76235
294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006711.1_g000026.1.cds

Sequence Viewer

Length: 294 bp
atggcgattaatggtggaaaaacctattcagccaaatgcaatagttttgtgatggcccgaacttgccgtgcgcatggtgagctcaagcttggagagaccatcaccaaagagttaaacagggctgaacctatgcatgagtcgaactatgtcctgctttccaacatctatgcaaaaatgaaccattgggagaagaaaaccaagactagagaggcgatggacaagaaagggatgaaaaagatccttgggagcactaagattgagctagataatgaaatttacaaatttgtggcataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DYW_deaminase PPR PPR_2 PPR_3

Protein Analysis

97

Amino Acids

11.09

Weight (kDa)

9.52

Isoelectric Point (pI)

30.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 72
AclWI GGATC 1 cut(s) 232
AcsI RAATTY 2 cut(s) 273, 281
AluBI AGCT 3 cut(s) 82, 88, 262
AluI AGCT 3 cut(s) 82, 88, 262
Alw21I GWGCWC 2 cut(s) 84, 251
Alw26I GTCTC 1 cut(s) 89
AlwI GGATC 1 cut(s) 232
AoxI GGCC 1 cut(s) 54
ApoI RAATTY 2 cut(s) 273, 281
AseI ATTAAT 1 cut(s) 9
AspLEI GCGC 1 cut(s) 73
AspS9I GGNCC 1 cut(s) 55
AsuHPI GGTGA 2 cut(s) 89, 94
BanII GRGCYC 1 cut(s) 84
Bbv12I GWGCWC 2 cut(s) 84, 251
BccI CCATC 3 cut(s) 46, 107, 208
BceAI ACGGC 1 cut(s) 51
BcoDI GTCTC 1 cut(s) 89
BfaI CTAG 2 cut(s) 204, 263
BmgT120I GGNCC 1 cut(s) 55
BpuEI CTTGAG 1 cut(s) 68
BsaI GGTCTC 1 cut(s) 89
BsaJI CCNNGG 1 cut(s) 241
BseDI CCNNGG 1 cut(s) 241
BseGI GGATG 1 cut(s) 234
BshFI GGCC 1 cut(s) 56
BsiHKAI GWGCWC 2 cut(s) 84, 251
BsmAI GTCTC 1 cut(s) 89
BsnI GGCC 1 cut(s) 56
Bso31I GGTCTC 1 cut(s) 89
Bsp1286I GDGCHC 2 cut(s) 84, 251
Bsp143I GATC 1 cut(s) 237
BspANI GGCC 1 cut(s) 56
BspPI GGATC 1 cut(s) 232
BspTNI GGTCTC 1 cut(s) 89
BssECI CCNNGG 1 cut(s) 241
BssMI GATC 1 cut(s) 237
BssT1I CCWWGG 1 cut(s) 241
BstDEI CTNAG 1 cut(s) 252
BstF5I GGATG 1 cut(s) 234
BstHHI GCGC 1 cut(s) 73
BstKTI GATC 1 cut(s) 240
BstMAI GTCTC 1 cut(s) 89
BstMBI GATC 1 cut(s) 237
BstMWI GCNNNNNNNGC 1 cut(s) 79
BstX2I RGATCY 1 cut(s) 237
BstYI RGATCY 1 cut(s) 237
BsuRI GGCC 1 cut(s) 56
BtgZI GCGATG 1 cut(s) 227
BtsCI GGATG 1 cut(s) 234
CfoI GCGC 1 cut(s) 73
Cfr13I GGNCC 1 cut(s) 55
CviAII CATG 2 cut(s) 74, 134
CviJI RGCY 6 cut(s) 32, 56, 82, 88, 122, 262
CviKI_1 RGCY 6 cut(s) 32, 56, 82, 88, 122, 262
DdeI CTNAG 1 cut(s) 252
DpnI GATC 1 cut(s) 239
DpnII GATC 1 cut(s) 237
Ecl136II GAGCTC 1 cut(s) 82
Eco130I CCWWGG 1 cut(s) 241
Eco24I GRGCYC 1 cut(s) 84
Eco31I GGTCTC 1 cut(s) 89
Eco53kI GAGCTC 1 cut(s) 82
EcoICRI GAGCTC 1 cut(s) 82
EcoT14I CCWWGG 1 cut(s) 241
EcoT22I ATGCAT 1 cut(s) 135
EcoT38I GRGCYC 1 cut(s) 84
ErhI CCWWGG 1 cut(s) 241
FaeI CATG 2 cut(s) 77, 137
FaiI YATR 6 cut(s) 75, 131, 135, 147, 168, 292
FatI CATG 2 cut(s) 73, 133
FokI GGATG 1 cut(s) 241
FriOI GRGCYC 1 cut(s) 84
FspAI RTGCGCAY 1 cut(s) 72
FspBI CTAG 2 cut(s) 204, 263
FspI TGCGCA 1 cut(s) 72
GlaI GCGC 1 cut(s) 72
HaeIII GGCC 1 cut(s) 56
HhaI GCGC 1 cut(s) 73
Hin1II CATG 2 cut(s) 77, 137
Hin6I GCGC 1 cut(s) 71
HinP1I GCGC 1 cut(s) 71
HindIII AAGCTT 1 cut(s) 86
HinfI GANTC 1 cut(s) 137
HphI GGTGA 2 cut(s) 89, 94
HpyCH4V TGCA 3 cut(s) 39, 133, 170
HpyF10VI GCNNNNNNNGC 1 cut(s) 79
HpyF3I CTNAG 1 cut(s) 252
Hsp92II CATG 2 cut(s) 77, 137
HspAI GCGC 1 cut(s) 71
Kzo9I GATC 1 cut(s) 237
LmnI GCTCC 1 cut(s) 246
LpnPI CCDG 2 cut(s) 103, 164
MaeI CTAG 2 cut(s) 204, 263
MalI GATC 1 cut(s) 239
MboI GATC 1 cut(s) 237
MboII GAAGA 1 cut(s) 202
MflI RGATCY 1 cut(s) 237
MhlI GDGCHC 2 cut(s) 84, 251
MluCI AATT 2 cut(s) 273, 281
MlyI GAGTC 1 cut(s) 146
MmeI TCCRAC 1 cut(s) 183
MnlI CCTC 1 cut(s) 202
Mph1103I ATGCAT 1 cut(s) 135
MseI TTAA 2 cut(s) 9, 113
MwoI GCNNNNNNNGC 1 cut(s) 79
NdeII GATC 1 cut(s) 237
NlaIII CATG 2 cut(s) 77, 137
NsbI TGCGCA 1 cut(s) 72
NsiI ATGCAT 1 cut(s) 135
PleI GAGTC 1 cut(s) 145
PpsI GAGTC 1 cut(s) 145
PshBI ATTAAT 1 cut(s) 9
Psp124BI GAGCTC 1 cut(s) 84
PspPI GGNCC 1 cut(s) 55
PsuI RGATCY 1 cut(s) 237
SacI GAGCTC 1 cut(s) 84
SaqAI TTAA 2 cut(s) 9, 113
Sau3AI GATC 1 cut(s) 237
Sau96I GGNCC 1 cut(s) 55
SchI GAGTC 1 cut(s) 146
SduI GDGCHC 2 cut(s) 84, 251
SetI ASST 5 cut(s) 26, 84, 90, 130, 264
SmlI CTYRAG 1 cut(s) 83
SmoI CTYRAG 1 cut(s) 83
Sse9I AATT 2 cut(s) 273, 281
SspMI CTAG 2 cut(s) 204, 263
SstI GAGCTC 1 cut(s) 84
StyI CCWWGG 1 cut(s) 241
TaqI TCGA 1 cut(s) 140
TasI AATT 2 cut(s) 273, 281
Tru1I TTAA 2 cut(s) 9, 113
Tru9I TTAA 2 cut(s) 9, 113
TspDTI ATGAA 3 cut(s) 191, 245, 285
VspI ATTAAT 1 cut(s) 9
XapI RAATTY 2 cut(s) 273, 281
XspI CTAG 2 cut(s) 204, 263
Zsp2I ATGCAT 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.