Rmu_sc0011203.1_g000021

Long chain base biosynthesis protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011203.1
Physical Location & Seq
Reverse (-)
61874 .. 62486
613 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011203.1_g000021.1.cds

Sequence Viewer

Length: 285 bp
atgggacacgccttagccgcagaaggaggattctgcactggaagtgctagagttactgatcaccagcgattgagcagttctgggtacgtcttttctgcttctttgccgccatatcttgcgagtgctgccattactgccattgatgttcttgaggagaaccctgatctgataacgaagttgaagaaaaacattatgtacgttactatggaaagattgtcaggtgtaatgggggttgcttatattcaagaagttgggaaagccagcctcttttttgagttaggctag
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

10.01

Weight (kDa)

5.53

Isoelectric Point (pI)

27.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 18, 107
AfaI GTAC 2 cut(s) 86, 197
AgsI TTSAA 2 cut(s) 181, 245
ApeKI GCWGC 1 cut(s) 125
AsuHPI GGTGA 1 cut(s) 53
BbvI GCAGC 1 cut(s) 112
BclI TGATCA 1 cut(s) 58
BfaI CTAG 2 cut(s) 48, 283
BisI GCNGC 3 cut(s) 18, 107, 126
BlsI GCNGC 3 cut(s) 19, 108, 127
Bpu10I CCTNAGC 1 cut(s) 13
BpuEI CTTGAG 1 cut(s) 170
Bse1I ACTGG 1 cut(s) 43
BseNI ACTGG 1 cut(s) 43
BseRI GAGGAG 1 cut(s) 167
BseXI GCAGC 1 cut(s) 112
BsgI GTGCAG 1 cut(s) 19
BslFI GGGAC 1 cut(s) 18
BsmFI GGGAC 1 cut(s) 18
Bsp143I GATC 2 cut(s) 58, 163
BspACI CCGC 2 cut(s) 18, 107
BsrI ACTGG 1 cut(s) 43
BssMI GATC 2 cut(s) 58, 163
BstC8I GCNNGC 1 cut(s) 262
BstDEI CTNAG 1 cut(s) 13
BstKTI GATC 2 cut(s) 61, 166
BstMBI GATC 2 cut(s) 58, 163
BstMWI GCNNNNNNNGC 3 cut(s) 17, 125, 134
BstV1I GCAGC 1 cut(s) 112
BtsIMutI CAGTG 1 cut(s) 36
Cac8I GCNNGC 1 cut(s) 262
Csp6I GTAC 2 cut(s) 85, 196
CviJI RGCY 4 cut(s) 17, 260, 264, 282
CviKI_1 RGCY 4 cut(s) 17, 260, 264, 282
CviQI GTAC 2 cut(s) 85, 196
DdeI CTNAG 1 cut(s) 13
DpnI GATC 2 cut(s) 60, 165
DpnII GATC 2 cut(s) 58, 163
FaiI YATR 4 cut(s) 112, 194, 206, 240
FaqI GGGAC 1 cut(s) 18
FbaI TGATCA 1 cut(s) 58
Fnu4HI GCNGC 3 cut(s) 18, 107, 126
Fsp4HI GCNGC 3 cut(s) 18, 107, 126
FspBI CTAG 2 cut(s) 48, 283
GluI GCNGC 3 cut(s) 18, 107, 126
HinfI GANTC 1 cut(s) 30
HphI GGTGA 1 cut(s) 53
Hpy188I TCNGA 1 cut(s) 168
Hpy188III TCNNGA 2 cut(s) 149, 245
HpyAV CCTTC 1 cut(s) 17
HpyCH4IV ACGT 2 cut(s) 87, 198
HpyCH4V TGCA 1 cut(s) 36
HpyF10VI GCNNNNNNNGC 3 cut(s) 17, 125, 134
HpyF3I CTNAG 1 cut(s) 13
HpySE526I ACGT 2 cut(s) 87, 198
Ksp22I TGATCA 1 cut(s) 58
Kzo9I GATC 2 cut(s) 58, 163
LpnPI CCDG 6 cut(s) 24, 66, 77, 174, 204, 274
Lsp1109I GCAGC 1 cut(s) 112
MaeI CTAG 2 cut(s) 48, 283
MaeII ACGT 2 cut(s) 87, 198
MaeIII GTNAC 2 cut(s) 52, 199
MalI GATC 2 cut(s) 60, 165
MboI GATC 2 cut(s) 58, 163
MboII GAAGA 1 cut(s) 193
MnlI CCTC 3 cut(s) 20, 145, 275
MwoI GCNNNNNNNGC 3 cut(s) 17, 125, 134
NdeII GATC 2 cut(s) 58, 163
PfeI GAWTC 1 cut(s) 30
PkrI GCNGC 3 cut(s) 19, 108, 127
RsaI GTAC 2 cut(s) 86, 197
RsaNI GTAC 2 cut(s) 85, 196
SatI GCNGC 3 cut(s) 18, 107, 126
Sau3AI GATC 2 cut(s) 58, 163
SetI ASST 3 cut(s) 90, 201, 223
SmlI CTYRAG 1 cut(s) 149
SmoI CTYRAG 1 cut(s) 149
SsiI CCGC 2 cut(s) 18, 107
SspMI CTAG 2 cut(s) 48, 283
TaiI ACGT 2 cut(s) 90, 201
TauI GCSGC 2 cut(s) 20, 109
TfiI GAWTC 1 cut(s) 30
TscAI CASTG 1 cut(s) 43
TseI GCWGC 1 cut(s) 125
TspRI CASTG 1 cut(s) 43
XspI CTAG 2 cut(s) 48, 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.