Rh6CG013300

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
1489087 .. 1489666
580 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG013300.1

Sequence Viewer

Length: 279 bp
ATGAACCATTGGGAGAAGAAAACCAAGACTACAGAGGCGATGGACGATGGACAAGAAAGGGATGAAAAGATCCCTGGGAGCACAATGATTGAGCTAGATAATGAAATTTACGGATTTGTGGCAGGAGAGAAATCGCATAAACTGTCCAAAGAGATTTATGAAATGGTTGATGAAATGGGGAGGAAGATGAGGAGGGCTGGATATGTTCCCACTACATCAGATCACACTAGTCTGGAAACTACAACGATTGACAACTTCCCATATCCAGATTATTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

92

Amino Acids

10.65

Weight (kDa)

4.86

Isoelectric Point (pI)

29.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 64
AcsI RAATTY 1 cut(s) 105
AhlI ACTAGT 1 cut(s) 227
AjnI CCWGG 1 cut(s) 73
AluBI AGCT 1 cut(s) 94
AluI AGCT 1 cut(s) 94
Alw21I GWGCWC 1 cut(s) 83
AlwI GGATC 1 cut(s) 64
ApoI RAATTY 1 cut(s) 105
Bbv12I GWGCWC 1 cut(s) 83
BccI CCATC 2 cut(s) 34, 41
BciT130I CCWGG 1 cut(s) 75
BcuI ACTAGT 1 cut(s) 227
BfaI CTAG 2 cut(s) 95, 228
BfmI CTRYAG 1 cut(s) 30
Bme1390I CCNGG 1 cut(s) 75
BmrFI CCNGG 1 cut(s) 75
BsaJI CCNNGG 2 cut(s) 73, 74
BseBI CCWGG 1 cut(s) 75
BseDI CCNNGG 2 cut(s) 73, 74
BseGI GGATG 1 cut(s) 67
BseRI GAGGAG 1 cut(s) 205
BsiHKAI GWGCWC 1 cut(s) 83
Bsp1286I GDGCHC 1 cut(s) 83
Bsp143I GATC 2 cut(s) 69, 220
BspPI GGATC 1 cut(s) 64
BssECI CCNNGG 2 cut(s) 73, 74
BssMI GATC 2 cut(s) 69, 220
Bst2UI CCWGG 1 cut(s) 75
Bst4CI ACNGT 1 cut(s) 144
BstF5I GGATG 1 cut(s) 67
BstKTI GATC 2 cut(s) 72, 223
BstMBI GATC 2 cut(s) 69, 220
BstNI CCWGG 1 cut(s) 75
BstSCI CCNGG 1 cut(s) 73
BstSFI CTRYAG 1 cut(s) 30
BstX2I RGATCY 1 cut(s) 69
BstYI RGATCY 1 cut(s) 69
BtgZI GCGATG 1 cut(s) 53
BtsCI GGATG 1 cut(s) 67
CviJI RGCY 2 cut(s) 94, 197
CviKI_1 RGCY 2 cut(s) 94, 197
DpnI GATC 2 cut(s) 71, 222
DpnII GATC 2 cut(s) 69, 220
EcoRII CCWGG 1 cut(s) 73
FaiI YATR 4 cut(s) 138, 159, 204, 262
FokI GGATG 1 cut(s) 74
FspBI CTAG 2 cut(s) 95, 228
Hpy188I TCNGA 1 cut(s) 220
Hpy188III TCNNGA 3 cut(s) 233, 266, 276
HpyCH4III ACNGT 1 cut(s) 144
Kzo9I GATC 2 cut(s) 69, 220
LmnI GCTCC 1 cut(s) 78
LpnPI CCDG 5 cut(s) 60, 87, 108, 183, 218
MaeI CTAG 2 cut(s) 95, 228
MalI GATC 2 cut(s) 71, 222
MboI GATC 2 cut(s) 69, 220
MboII GAAGA 2 cut(s) 28, 196
MflI RGATCY 1 cut(s) 69
MhlI GDGCHC 1 cut(s) 83
MluCI AATT 1 cut(s) 105
MnlI CCTC 4 cut(s) 28, 174, 183, 186
MspR9I CCNGG 1 cut(s) 75
MvaI CCWGG 1 cut(s) 75
NdeII GATC 2 cut(s) 69, 220
PasI CCCWGGG 1 cut(s) 74
Psp6I CCWGG 1 cut(s) 73
PspGI CCWGG 1 cut(s) 73
PsuI RGATCY 1 cut(s) 69
Sau3AI GATC 2 cut(s) 69, 220
ScrFI CCNGG 1 cut(s) 75
SduI GDGCHC 1 cut(s) 83
SetI ASST 1 cut(s) 96
SfcI CTRYAG 1 cut(s) 30
SgeI CNNG 9 cut(s) 37, 65, 86, 87, 107, 135, 210, 240, 245
SpeI ACTAGT 1 cut(s) 227
Sse9I AATT 1 cut(s) 105
SspMI CTAG 2 cut(s) 95, 228
StyD4I CCNGG 1 cut(s) 73
TaaI ACNGT 1 cut(s) 144
TasI AATT 1 cut(s) 105
TspDTI ATGAA 5 cut(s) 17, 78, 117, 174, 186
TspGWI ACGGA 1 cut(s) 126
XapI RAATTY 1 cut(s) 105
XspI CTAG 2 cut(s) 95, 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.