Rh6DG014500

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0007526
Physical Location & Seq
Forward (+)
1408727 .. 1409047
321 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG014500.1

Sequence Viewer

Length: 321 bp
ATGAACCATTGGGAGAAGAAAACCAAGACTACAGAGGCGATGGACGATGGACAAGAAAGGGATGAAAAGATCCCTGGGAGCACAATGATTGAGCTAGATAATGAAATTTACGGATTTGTGGCAGGAGAGAAATCGCATAAACTGTCCAAAGAGATTTATGAAATGGTTGATGAAATGGGGAGGAAGATGAGGAGGGCTGGATATGTTCCCACTACATCAGAGTTTTTGCTAGGCATTGATGAAGAAGATAAAGAAGATGCTTTAAATAGGCATAGTGAAAAGTTGGCCATTGCTTTCGCCCTCCTGAACACACCATCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DYW_deaminase PPR PPR_2 PPR_3

Protein Analysis

106

Amino Acids

12.14

Weight (kDa)

4.87

Isoelectric Point (pI)

37.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DYW_deaminase PF14432 67 - 105 9.8e-08 DYW family of nucleic acid deaminases
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 64
AcoI YGGCCR 1 cut(s) 285
AcsI RAATTY 1 cut(s) 105
AjnI CCWGG 1 cut(s) 73
AleI CACNNNNGTG 1 cut(s) 316
AluBI AGCT 1 cut(s) 94
AluI AGCT 1 cut(s) 94
Alw21I GWGCWC 1 cut(s) 83
AlwI GGATC 1 cut(s) 64
AoxI GGCC 1 cut(s) 285
ApoI RAATTY 1 cut(s) 105
BalI TGGCCA 1 cut(s) 287
Bbv12I GWGCWC 1 cut(s) 83
BccI CCATC 2 cut(s) 34, 41
BciT130I CCWGG 1 cut(s) 75
BfaI CTAG 2 cut(s) 95, 230
BfmI CTRYAG 1 cut(s) 30
Bme1390I CCNGG 1 cut(s) 75
BmrFI CCNGG 1 cut(s) 75
BmsI GCATC 1 cut(s) 247
BsaJI CCNNGG 2 cut(s) 73, 74
Bse3DI GCAATG 1 cut(s) 288
BseBI CCWGG 1 cut(s) 75
BseDI CCNNGG 2 cut(s) 73, 74
BseGI GGATG 1 cut(s) 67
BseMI GCAATG 1 cut(s) 288
BseRI GAGGAG 1 cut(s) 205
BshFI GGCC 1 cut(s) 287
BsiHKAI GWGCWC 1 cut(s) 83
BsnI GGCC 1 cut(s) 287
Bsp1286I GDGCHC 1 cut(s) 83
Bsp143I GATC 1 cut(s) 69
BspANI GGCC 1 cut(s) 287
BspPI GGATC 1 cut(s) 64
BsrDI GCAATG 1 cut(s) 288
BssECI CCNNGG 2 cut(s) 73, 74
BssMI GATC 1 cut(s) 69
Bst2UI CCWGG 1 cut(s) 75
Bst4CI ACNGT 1 cut(s) 144
BstF5I GGATG 1 cut(s) 67
BstKTI GATC 1 cut(s) 72
BstMBI GATC 1 cut(s) 69
BstNI CCWGG 1 cut(s) 75
BstSCI CCNGG 1 cut(s) 73
BstSFI CTRYAG 1 cut(s) 30
BstX2I RGATCY 1 cut(s) 69
BstYI RGATCY 1 cut(s) 69
BsuRI GGCC 1 cut(s) 287
BtgZI GCGATG 1 cut(s) 53
BtsCI GGATG 1 cut(s) 67
CviJI RGCY 3 cut(s) 94, 197, 287
CviKI_1 RGCY 3 cut(s) 94, 197, 287
DpnI GATC 1 cut(s) 71
DpnII GATC 1 cut(s) 69
DraI TTTAAA 1 cut(s) 264
EaeI YGGCCR 1 cut(s) 285
EcoRII CCWGG 1 cut(s) 73
FaiI YATR 4 cut(s) 138, 159, 204, 273
FokI GGATG 1 cut(s) 74
FspBI CTAG 2 cut(s) 95, 230
HaeIII GGCC 1 cut(s) 287
Hpy188I TCNGA 1 cut(s) 220
Hpy188III TCNNGA 2 cut(s) 304, 318
HpyCH4III ACNGT 1 cut(s) 144
Kzo9I GATC 1 cut(s) 69
LmnI GCTCC 1 cut(s) 78
LpnPI CCDG 5 cut(s) 60, 87, 108, 183, 317
LweI GCATC 1 cut(s) 247
MaeI CTAG 2 cut(s) 95, 230
MalI GATC 1 cut(s) 71
MboI GATC 1 cut(s) 69
MboII GAAGA 5 cut(s) 28, 196, 254, 257, 266
MflI RGATCY 1 cut(s) 69
MhlI GDGCHC 1 cut(s) 83
MlsI TGGCCA 1 cut(s) 287
MluCI AATT 1 cut(s) 105
MluNI TGGCCA 1 cut(s) 287
MnlI CCTC 5 cut(s) 28, 174, 183, 186, 311
Mox20I TGGCCA 1 cut(s) 287
MscI TGGCCA 1 cut(s) 287
MseI TTAA 1 cut(s) 263
MslI CAYNNNNRTG 1 cut(s) 316
Msp20I TGGCCA 1 cut(s) 287
MspR9I CCNGG 1 cut(s) 75
MvaI CCWGG 1 cut(s) 75
NdeII GATC 1 cut(s) 69
OliI CACNNNNGTG 1 cut(s) 316
PasI CCCWGGG 1 cut(s) 74
Psp6I CCWGG 1 cut(s) 73
PspGI CCWGG 1 cut(s) 73
PsuI RGATCY 1 cut(s) 69
RseI CAYNNNNRTG 1 cut(s) 316
SaqAI TTAA 1 cut(s) 263
Sau3AI GATC 1 cut(s) 69
ScrFI CCNGG 1 cut(s) 75
SduI GDGCHC 1 cut(s) 83
SetI ASST 1 cut(s) 96
SfaNI GCATC 1 cut(s) 247
SfcI CTRYAG 1 cut(s) 30
SgeI CNNG 9 cut(s) 37, 65, 86, 87, 107, 135, 210, 242, 316
SmiMI CAYNNNNRTG 1 cut(s) 316
Sse9I AATT 1 cut(s) 105
SspMI CTAG 2 cut(s) 95, 230
StyD4I CCNGG 1 cut(s) 73
TaaI ACNGT 1 cut(s) 144
TasI AATT 1 cut(s) 105
Tru1I TTAA 1 cut(s) 263
Tru9I TTAA 1 cut(s) 263
TspDTI ATGAA 6 cut(s) 17, 78, 117, 174, 186, 255
TspGWI ACGGA 1 cut(s) 126
XapI RAATTY 1 cut(s) 105
XspI CTAG 2 cut(s) 95, 230
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.