Rmu_sc0007182.1_g000001

Transcription initiation factor IIF subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007182.1
Physical Location & Seq
Forward (+)
1 .. 271
271 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007182.1_g000001.1.cds

Sequence Viewer

Length: 173 bp
gtgatgattgggagaacgaagaaatattcaccgatgatgatgaagctgttggtattaatcctgaggagagagaagaattcgaacctgaggttccagctcctccagaaattaagcaggtttgccacacacattcctttagttatgggaatttatttttggcacttctgagttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.45

Weight (kDa)

4.05

Isoelectric Point (pI)

59.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 105
AcsI RAATTY 2 cut(s) 76, 147
AjuI GAANNNNNNNTTGG 2 cut(s) 139, 171
AluBI AGCT 2 cut(s) 46, 97
AluI AGCT 2 cut(s) 46, 97
ApoI RAATTY 2 cut(s) 76, 147
AseI ATTAAT 1 cut(s) 56
AsuHPI GGTGA 1 cut(s) 21
AsuII TTCGAA 1 cut(s) 80
AxyI CCTNAGG 2 cut(s) 62, 86
BfuAI ACCTGC 1 cut(s) 105
BmiI GGNNCC 1 cut(s) 92
BpmI CTGGAG 1 cut(s) 86
Bpu14I TTCGAA 1 cut(s) 80
Bse21I CCTNAGG 2 cut(s) 62, 86
BseMII CTCAG 3 cut(s) 53, 77, 157
BseRI GAGGAG 2 cut(s) 79, 89
Bsp119I TTCGAA 1 cut(s) 80
BspCNI CTCAG 3 cut(s) 54, 78, 158
BspLI GGNNCC 1 cut(s) 92
BspMI ACCTGC 1 cut(s) 105
BspT104I TTCGAA 1 cut(s) 80
BstBI TTCGAA 1 cut(s) 80
BstDEI CTNAG 3 cut(s) 62, 86, 166
Bsu36I CCTNAGG 2 cut(s) 62, 86
BveI ACCTGC 1 cut(s) 105
CviJI RGCY 2 cut(s) 46, 97
CviKI_1 RGCY 2 cut(s) 46, 97
DdeI CTNAG 3 cut(s) 62, 86, 166
Eco81I CCTNAGG 2 cut(s) 62, 86
EcoRI GAATTC 1 cut(s) 76
FaiI YATR 1 cut(s) 143
GsuI CTGGAG 1 cut(s) 86
HphI GGTGA 1 cut(s) 21
Hpy188I TCNGA 1 cut(s) 167
Hpy188III TCNNGA 2 cut(s) 61, 103
HpyF3I CTNAG 3 cut(s) 62, 86, 166
LmnI GCTCC 1 cut(s) 102
LpnPI CCDG 5 cut(s) 74, 98, 100, 107, 116
MboII GAAGA 2 cut(s) 31, 85
MluCI AATT 3 cut(s) 76, 107, 147
MnlI CCTC 3 cut(s) 57, 81, 110
MseI TTAA 2 cut(s) 56, 110
NlaIV GGNNCC 1 cut(s) 92
NspV TTCGAA 1 cut(s) 80
PshBI ATTAAT 1 cut(s) 56
PspN4I GGNNCC 1 cut(s) 92
SaqAI TTAA 2 cut(s) 56, 110
SetI ASST 5 cut(s) 48, 87, 92, 99, 119
SfuI TTCGAA 1 cut(s) 80
SgeI CNNG 5 cut(s) 73, 97, 106, 115, 127
Sse9I AATT 3 cut(s) 76, 107, 147
SspI AATATT 1 cut(s) 26
TaqI TCGA 1 cut(s) 80
TasI AATT 3 cut(s) 76, 107, 147
Tru1I TTAA 2 cut(s) 56, 110
Tru9I TTAA 2 cut(s) 56, 110
TspDTI ATGAA 1 cut(s) 56
VspI ATTAAT 1 cut(s) 56
XapI RAATTY 2 cut(s) 76, 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.