Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008124.1

Orthogroup ID

OG0005159

Physical Location & Seq

Genomic Coordinates Forward (+)

100114 .. 102644

Gene Structure 2531 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008124.1_g000023.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 807 bp

atgaccgaggaggacgaggaggaggaagaggaggacgacgacgatgatgaatacggcccctatcgtggcggcggcggcgggagtcgagagaaaggatatggttataaaagatgctcgttccaccgcatcattaaggattttatgatccaaggaggggatttcactgaaggagatggaactggagggatcagtatctatggttccaaatttgatgatgagagctttgctttgaagcatgttgggcctggtgtattgagcatggctaatgcaggccctggtactaatgggagaatttggcctgaatctccaagttttaatgatgacaacatgcctccagtgccagctagatggaagggggtttgtcaatcaggagaggcattcaatgcttcaacttgcaacagtgattggggctactataagtccggttatgaagccgaggaagattctcggacacagtggcattcagttctccaagggacagtgccgctcaaggcacggcttgaggatggaaaagatatccgtctaggggactggaaaactgctgatgtcgagatcctgaatacctttcaattgctaacagctaagcctgttgtttacttggtaagtttaactcttgcatgttcacctgttttcaggagtaccatgcgccaggcttgtaatgcatcccaaaatgttgcaaacgtgtataagatgtatcgtgaagtaagggaagaaaattacatggagcaagaagatcaggatcgcgatctcactctgagggtggaagacttcaaaggtcaagatcaagagactgacgattttgtttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009532 GO:0009536 GO:0009570 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pro_isomerase

Protein Analysis

268

Amino Acids

30.11

Weight (kDa)

4.43

Isoelectric Point (pI)

53.51

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005159)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G62030 AT3G62030 AT3G62030
fragaria_vesca	FvH4_1g26090
malus_domestica	MD10G1124600.v1.1 MD17G1286000.v1.1
prunus_persica	Prupe.3G001000_v2.0.a1 Prupe.3G001000_v2.0.a1
pyrus_communis	pycom17g28180
rosa_chinensis	RchiOBHm_Chr2g0135271 RchiOBHm_Chr2g0163561 RchiOBHm_Chr3g0485561 RchiOBHm_Chr3g0491891 RchiOBHm_Chr7g0181211
rosa_multiflora	Rmu_sc0001272.1_g000012 Rmu_sc0004711.1_g000017 Rmu_sc0008124.1_g000023 Rmu_sc0011240.1_g000010
rosa_roxburghii	Rroxscaffold_6G00396620 Rroxscaffold_6G00396920
rosa_rugosa	Rorug03G0220100
rosa_samantha	Rh3BG085100 Rh3BG304200 Rh3CG085300 Rh3CG302500 Rh3DG299100 Rh4CG129700 Rh7DG041000
rosa_wichuraiana	Rw3G023950 Rw3G024060

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	105
AccBSI	CCGCTC	1 cut(s)	487
AccII	CGCG	1 cut(s)	744
AciI	CCGC	6 cut(s)	69, 72, 75, 78, 124, 485
AclWI	GGATC	4 cut(s)	139, 194, 547, 747
AcsI	RAATTY	2 cut(s)	206, 291
AcuI	CTGAAG	1 cut(s)	186
AfaI	GTAC	2 cut(s)	280, 640
AfiI	CCNNNNNNNGG	3 cut(s)	65, 154, 526
AflIII	ACRYGT	1 cut(s)	681
AgsI	TTSAA	5 cut(s)	232, 382, 390, 569, 772
AjnI	CCWGG	3 cut(s)	244, 274, 648
AluBI	AGCT	3 cut(s)	222, 344, 581
AluI	AGCT	3 cut(s)	222, 344, 581
Alw26I	GTCTC	1 cut(s)	782
AlwI	GGATC	4 cut(s)	139, 194, 547, 747
AlwNI	CAGNNNCTG	1 cut(s)	275
AoxI	GGCC	4 cut(s)	55, 242, 271, 296
ApoI	RAATTY	2 cut(s)	206, 291
AspLEI	GCGC	1 cut(s)	648
AspS9I	GGNCC	3 cut(s)	56, 242, 272
AsuHPI	GGTGA	1 cut(s)	615
BbsI	GAAGAC	1 cut(s)	771
BccI	CCATC	3 cut(s)	167, 342, 500
BceAI	ACGGC	2 cut(s)	70, 512
BciT130I	CCWGG	3 cut(s)	246, 276, 650
BcoDI	GTCTC	1 cut(s)	782
BfaI	CTAG	2 cut(s)	345, 524
BisI	GCNGC	4 cut(s)	70, 73, 76, 485
BlpI	GCTNAGC	1 cut(s)	582
BlsI	GCNGC	4 cut(s)	71, 74, 77, 486
Bme1390I	CCNGG	3 cut(s)	246, 276, 650
BmgT120I	GGNCC	3 cut(s)	56, 242, 272
BmiI	GGNNCC	2 cut(s)	58, 202
BmrFI	CCNGG	3 cut(s)	246, 276, 650
BmsI	GCATC	3 cut(s)	101, 135, 671
BpiI	GAAGAC	1 cut(s)	771
BpmI	CTGGAG	2 cut(s)	201, 318
Bpu1102I	GCTNAGC	1 cut(s)	582
BpuEI	CTTGAG	2 cut(s)	473, 521
BsaBI	GATNNNNATC	3 cut(s)	191, 738, 744
BsaJI	CCNNGG	5 cut(s)	6, 148, 274, 435, 472
BsaWI	WCCGGW	1 cut(s)	422
Bsc4I	CCNNNNNNNGG	3 cut(s)	65, 154, 526
Bse1I	ACTGG	3 cut(s)	184, 335, 536
Bse8I	GATNNNNATC	3 cut(s)	191, 738, 744
BseBI	CCWGG	3 cut(s)	246, 276, 650
BseDI	CCNNGG	5 cut(s)	6, 148, 274, 435, 472
BseGI	GGATG	2 cut(s)	511, 662
BseJI	GATNNNNATC	3 cut(s)	191, 738, 744
BseLI	CCNNNNNNNGG	3 cut(s)	65, 154, 526
BseMII	CTCAG	1 cut(s)	746
BseNI	ACTGG	3 cut(s)	184, 335, 536
BseRI	GAGGAG	4 cut(s)	23, 32, 35, 44
Bsh1236I	CGCG	1 cut(s)	744
BshFI	GGCC	4 cut(s)	57, 244, 273, 298
BsiSI	CCGG	1 cut(s)	423
BslFI	GGGAC	2 cut(s)	490, 542
BslI	CCNNNNNNNGG	3 cut(s)	65, 154, 526
BsmAI	GTCTC	1 cut(s)	782
BsmFI	GGGAC	2 cut(s)	490, 542
BsmI	GAATGC	2 cut(s)	377, 460
BsnI	GGCC	4 cut(s)	57, 244, 273, 298
Bsp143I	GATC	7 cut(s)	144, 186, 552, 733, 739, 745, 781
Bsp1720I	GCTNAGC	1 cut(s)	582
Bsp68I	TCGCGA	1 cut(s)	744
BspACI	CCGC	6 cut(s)	69, 72, 75, 78, 124, 485
BspANI	GGCC	4 cut(s)	57, 244, 273, 298
BspCNI	CTCAG	1 cut(s)	747
BspFNI	CGCG	1 cut(s)	744
BspLI	GGNNCC	2 cut(s)	58, 202
BspPI	GGATC	4 cut(s)	139, 194, 547, 747
BsrBI	CCGCTC	1 cut(s)	487
BsrI	ACTGG	3 cut(s)	184, 335, 536
BssECI	CCNNGG	5 cut(s)	6, 148, 274, 435, 472
BssMI	GATC	7 cut(s)	144, 186, 552, 733, 739, 745, 781
BssT1I	CCWWGG	2 cut(s)	148, 472
Bst2UI	CCWGG	3 cut(s)	246, 276, 650
Bst4CI	ACNGT	3 cut(s)	401, 456, 481
Bst6I	CTCTTC	1 cut(s)	21
BstAPI	GCANNNNNTGC	1 cut(s)	383
BstC8I	GCNNGC	2 cut(s)	271, 342
BstDEI	CTNAG	2 cut(s)	582, 755
BstF5I	GGATG	2 cut(s)	511, 662
BstFNI	CGCG	1 cut(s)	744
BstHHI	GCGC	1 cut(s)	648
BstKTI	GATC	7 cut(s)	147, 189, 555, 736, 742, 748, 784
BstMAI	GTCTC	1 cut(s)	782
BstMBI	GATC	7 cut(s)	144, 186, 552, 733, 739, 745, 781
BstMWI	GCNNNNNNNGC	5 cut(s)	75, 241, 337, 383, 659
BstNI	CCWGG	3 cut(s)	246, 276, 650
BstNSI	RCATGY	3 cut(s)	239, 331, 621
BstSCI	CCNGG	3 cut(s)	244, 274, 648
BstUI	CGCG	1 cut(s)	744
BstV2I	GAAGAC	1 cut(s)	771
BstX2I	RGATCY	1 cut(s)	552
BstXI	CCANNNNNNTGG	1 cut(s)	348
BstYI	RGATCY	1 cut(s)	552
BsuRI	GGCC	4 cut(s)	57, 244, 273, 298
BtsCI	GGATG	2 cut(s)	511, 662
BtsIMutI	CAGTG	5 cut(s)	162, 342, 406, 461, 486
BtuMI	TCGCGA	1 cut(s)	744
Cac8I	GCNNGC	2 cut(s)	271, 342
CaiI	CAGNNNCTG	1 cut(s)	275
CfoI	GCGC	1 cut(s)	648
Cfr13I	GGNCC	3 cut(s)	56, 242, 272
Csp6I	GTAC	2 cut(s)	279, 639
CviAII	CATG	6 cut(s)	236, 259, 328, 618, 643, 721
CviQI	GTAC	2 cut(s)	279, 639
DdeI	CTNAG	2 cut(s)	582, 755
DpnI	GATC	7 cut(s)	146, 188, 554, 735, 741, 747, 783
DpnII	GATC	7 cut(s)	144, 186, 552, 733, 739, 745, 781
Eam1104I	CTCTTC	1 cut(s)	21
EarI	CTCTTC	1 cut(s)	21
Eco130I	CCWWGG	2 cut(s)	148, 472
Eco32I	GATATC	1 cut(s)	517
Eco57I	CTGAAG	1 cut(s)	186
EcoO109I	RGGNCCY	1 cut(s)	272
EcoRII	CCWGG	3 cut(s)	244, 274, 648
EcoRV	GATATC	1 cut(s)	517
EcoT14I	CCWWGG	2 cut(s)	148, 472
EcoT22I	ATGCAT	1 cut(s)	664
ErhI	CCWWGG	2 cut(s)	148, 472
FaeI	CATG	6 cut(s)	239, 262, 331, 621, 646, 724
FaqI	GGGAC	2 cut(s)	490, 542
FatI	CATG	6 cut(s)	235, 258, 327, 617, 642, 720
FauI	CCCGC	1 cut(s)	71
Fnu4HI	GCNGC	4 cut(s)	70, 73, 76, 485
FokI	GGATG	2 cut(s)	518, 649
Fsp4HI	GCNGC	4 cut(s)	70, 73, 76, 485
FspBI	CTAG	2 cut(s)	345, 524
GlaI	GCGC	1 cut(s)	647
GluI	GCNGC	4 cut(s)	70, 73, 76, 485
GsuI	CTGGAG	2 cut(s)	201, 318
HaeIII	GGCC	4 cut(s)	57, 244, 273, 298
HapII	CCGG	1 cut(s)	423
HhaI	GCGC	1 cut(s)	648
Hin1II	CATG	6 cut(s)	239, 262, 331, 621, 646, 724
Hin6I	GCGC	1 cut(s)	646
HinP1I	GCGC	1 cut(s)	646
HinfI	GANTC	3 cut(s)	82, 302, 443
HpaII	CCGG	1 cut(s)	423
HphI	GGTGA	1 cut(s)	615
Hpy166II	GTNNAC	2 cut(s)	595, 623
Hpy188I	TCNGA	2 cut(s)	450, 756
Hpy8I	GTNNAC	2 cut(s)	595, 623
Hpy99I	CGWCG	2 cut(s)	41, 44
HpyAV	CCTTC	2 cut(s)	161, 346
HpyCH4III	ACNGT	3 cut(s)	401, 456, 481
HpyCH4IV	ACGT	1 cut(s)	681
HpyCH4V	TGCA	5 cut(s)	269, 396, 617, 662, 677
HpyF10VI	GCNNNNNNNGC	5 cut(s)	75, 241, 337, 383, 659
HpyF3I	CTNAG	2 cut(s)	582, 755
HpySE526I	ACGT	1 cut(s)	681
Hsp92II	CATG	6 cut(s)	239, 262, 331, 621, 646, 724
HspAI	GCGC	1 cut(s)	646
Kzo9I	GATC	7 cut(s)	144, 186, 552, 733, 739, 745, 781
LmnI	GCTCC	1 cut(s)	724
LweI	GCATC	3 cut(s)	101, 135, 671
MaeI	CTAG	2 cut(s)	345, 524
MaeII	ACGT	1 cut(s)	681
MalI	GATC	7 cut(s)	146, 188, 554, 735, 741, 747, 783
MbiI	CCGCTC	1 cut(s)	487
MboI	GATC	7 cut(s)	144, 186, 552, 733, 739, 745, 781
MboII	GAAGA	5 cut(s)	38, 452, 722, 743, 776
MfeI	CAATTG	1 cut(s)	569
MflI	RGATCY	1 cut(s)	552
MluCI	AATT	4 cut(s)	206, 291, 569, 715
MlyI	GAGTC	1 cut(s)	91
Mph1103I	ATGCAT	1 cut(s)	664
MseI	TTAA	4 cut(s)	132, 315, 608, 805
MspI	CCGG	1 cut(s)	423
MspR9I	CCNGG	3 cut(s)	246, 276, 650
MunI	CAATTG	1 cut(s)	569
Mva1269I	GAATGC	2 cut(s)	377, 460
MvaI	CCWGG	3 cut(s)	246, 276, 650
MvnI	CGCG	1 cut(s)	744
MwoI	GCNNNNNNNGC	5 cut(s)	75, 241, 337, 383, 659
NdeII	GATC	7 cut(s)	144, 186, 552, 733, 739, 745, 781
NlaIII	CATG	6 cut(s)	239, 262, 331, 621, 646, 724
NlaIV	GGNNCC	2 cut(s)	58, 202
NmeAIII	GCCGAG	1 cut(s)	460
NruI	TCGCGA	1 cut(s)	744
NsiI	ATGCAT	1 cut(s)	664
NspI	RCATGY	3 cut(s)	239, 331, 621
PctI	GAATGC	2 cut(s)	377, 460
PfeI	GAWTC	2 cut(s)	302, 443
PkrI	GCNGC	4 cut(s)	71, 74, 77, 486
PleI	GAGTC	1 cut(s)	90
PpsI	GAGTC	1 cut(s)	90
PsiI	TTATAA	1 cut(s)	105
Psp6I	CCWGG	3 cut(s)	244, 274, 648
PspGI	CCWGG	3 cut(s)	244, 274, 648
PspN4I	GGNNCC	2 cut(s)	58, 202
PspPI	GGNCC	3 cut(s)	56, 242, 272
PsrI	GAACNNNNNNTAC	2 cut(s)	184, 216
PstNI	CAGNNNCTG	1 cut(s)	275
PsuI	RGATCY	1 cut(s)	552
RruI	TCGCGA	1 cut(s)	744
RsaI	GTAC	2 cut(s)	280, 640
RsaNI	GTAC	2 cut(s)	279, 639
SaqAI	TTAA	4 cut(s)	132, 315, 608, 805
SatI	GCNGC	4 cut(s)	70, 73, 76, 485
Sau3AI	GATC	7 cut(s)	144, 186, 552, 733, 739, 745, 781
Sau96I	GGNCC	3 cut(s)	56, 242, 272
SchI	GAGTC	1 cut(s)	91
ScrFI	CCNGG	3 cut(s)	246, 276, 650
SetI	ASST	7 cut(s)	224, 346, 566, 583, 628, 684, 778
SfaNI	GCATC	3 cut(s)	101, 135, 671
SmlI	CTYRAG	2 cut(s)	488, 500
SmoI	CTYRAG	2 cut(s)	488, 500
Sse9I	AATT	4 cut(s)	206, 291, 569, 715
SsiI	CCGC	6 cut(s)	69, 72, 75, 78, 124, 485
SspMI	CTAG	2 cut(s)	345, 524
StyD4I	CCNGG	3 cut(s)	244, 274, 648
StyI	CCWWGG	2 cut(s)	148, 472
TaaI	ACNGT	3 cut(s)	401, 456, 481
TaiI	ACGT	1 cut(s)	684
TaqI	TCGA	2 cut(s)	85, 549
TaqII	GACCGA	1 cut(s)	20
TasI	AATT	4 cut(s)	206, 291, 569, 715
TauI	GCSGC	4 cut(s)	72, 75, 78, 487
TfiI	GAWTC	2 cut(s)	302, 443
Tru1I	TTAA	4 cut(s)	132, 315, 608, 805
Tru9I	TTAA	4 cut(s)	132, 315, 608, 805
TscAI	CASTG	5 cut(s)	169, 342, 406, 461, 486
TspDTI	ATGAA	2 cut(s)	63, 444
TspGWI	ACGGA	1 cut(s)	509
TspRI	CASTG	5 cut(s)	169, 342, 406, 461, 486
XapI	RAATTY	2 cut(s)	206, 291
XceI	RCATGY	3 cut(s)	239, 331, 621
XspI	CTAG	2 cut(s)	345, 524
Zsp2I	ATGCAT	1 cut(s)	664

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.