Rh3CG085300

PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0005159
Physical Location & Seq
Forward (+)
6638899 .. 6639539
641 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG085300.1

Sequence Viewer

Length: 246 bp
ATGATCCAAGGAGGGGATTTCACTGAAGGAGATGGAACTGGAGGGATCAGTATCTATGGTTCCAAATTTGATGATGAGAGCTTTGCTTTGAAGCATGTTGGGCCTGGTGTATTGAGCATGGCTAATGCAGGCCCTGGTACTAATGGGAGTCAGTTTTTAATCGGCACAGTAAAGGAAAATGTGAAGACAAATCCTCAATTGCTGTATGAATCCAAGTTGTATAGGATCCTACAAGGAGGAAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009532 GO:0009536 GO:0009570 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pro_isomerase

Protein Analysis

81

Amino Acids

8.47

Weight (kDa)

5.08

Isoelectric Point (pI)

14.84

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pro_isomerase PF00160 1 - 64 2e-11 Cyclophilin type peptidyl-prolyl cis-trans isomerase/CLD
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 53, 220, 233
AcsI RAATTY 1 cut(s) 65
AcuI CTGAAG 1 cut(s) 45
AfaI GTAC 1 cut(s) 139
AfiI CCNNNNNNNGG 1 cut(s) 13
AgsI TTSAA 1 cut(s) 91
AjnI CCWGG 2 cut(s) 103, 133
AluBI AGCT 1 cut(s) 81
AluI AGCT 1 cut(s) 81
AlwI GGATC 3 cut(s) 53, 220, 233
AlwNI CAGNNNCTG 1 cut(s) 134
AoxI GGCC 2 cut(s) 101, 130
ApoI RAATTY 1 cut(s) 65
AspS9I GGNCC 2 cut(s) 101, 131
BamHI GGATCC 1 cut(s) 225
BbsI GAAGAC 1 cut(s) 191
BccI CCATC 1 cut(s) 26
BciT130I CCWGG 2 cut(s) 105, 135
Bme1390I CCNGG 2 cut(s) 105, 135
BmgT120I GGNCC 2 cut(s) 101, 131
BmiI GGNNCC 2 cut(s) 61, 227
BmrFI CCNGG 2 cut(s) 105, 135
BpiI GAAGAC 1 cut(s) 191
BpmI CTGGAG 1 cut(s) 60
BsaBI GATNNNNATC 1 cut(s) 50
BsaJI CCNNGG 2 cut(s) 7, 133
Bsc4I CCNNNNNNNGG 1 cut(s) 13
Bse1I ACTGG 1 cut(s) 43
Bse8I GATNNNNATC 1 cut(s) 50
BseBI CCWGG 2 cut(s) 105, 135
BseDI CCNNGG 2 cut(s) 7, 133
BseJI GATNNNNATC 1 cut(s) 50
BseLI CCNNNNNNNGG 1 cut(s) 13
BseNI ACTGG 1 cut(s) 43
BshFI GGCC 2 cut(s) 103, 132
BslI CCNNNNNNNGG 1 cut(s) 13
BsnI GGCC 2 cut(s) 103, 132
Bsp143I GATC 3 cut(s) 3, 45, 225
BspANI GGCC 2 cut(s) 103, 132
BspLI GGNNCC 2 cut(s) 61, 227
BspPI GGATC 3 cut(s) 53, 220, 233
BsrI ACTGG 1 cut(s) 43
BssECI CCNNGG 2 cut(s) 7, 133
BssMI GATC 3 cut(s) 3, 45, 225
BssT1I CCWWGG 1 cut(s) 7
Bst2UI CCWGG 2 cut(s) 105, 135
Bst4CI ACNGT 1 cut(s) 169
BstC8I GCNNGC 1 cut(s) 130
BstKTI GATC 3 cut(s) 6, 48, 228
BstMBI GATC 3 cut(s) 3, 45, 225
BstMWI GCNNNNNNNGC 1 cut(s) 100
BstNI CCWGG 2 cut(s) 105, 135
BstNSI RCATGY 1 cut(s) 98
BstSCI CCNGG 2 cut(s) 103, 133
BstV2I GAAGAC 1 cut(s) 191
BstX2I RGATCY 1 cut(s) 225
BstYI RGATCY 1 cut(s) 225
BsuRI GGCC 2 cut(s) 103, 132
BtsIMutI CAGTG 1 cut(s) 21
Cac8I GCNNGC 1 cut(s) 130
CaiI CAGNNNCTG 1 cut(s) 134
Cfr13I GGNCC 2 cut(s) 101, 131
Csp6I GTAC 1 cut(s) 138
CviAII CATG 2 cut(s) 95, 118
CviJI RGCY 4 cut(s) 81, 103, 122, 132
CviKI_1 RGCY 4 cut(s) 81, 103, 122, 132
CviQI GTAC 1 cut(s) 138
DpnI GATC 3 cut(s) 5, 47, 227
DpnII GATC 3 cut(s) 3, 45, 225
Eco130I CCWWGG 1 cut(s) 7
Eco57I CTGAAG 1 cut(s) 45
EcoO109I RGGNCCY 1 cut(s) 131
EcoRII CCWGG 2 cut(s) 103, 133
EcoT14I CCWWGG 1 cut(s) 7
ErhI CCWWGG 1 cut(s) 7
FaeI CATG 2 cut(s) 98, 121
FaiI YATR 5 cut(s) 57, 96, 119, 207, 222
FatI CATG 2 cut(s) 94, 117
GsuI CTGGAG 1 cut(s) 60
HaeIII GGCC 2 cut(s) 103, 132
Hin1II CATG 2 cut(s) 98, 121
HinfI GANTC 2 cut(s) 148, 209
HpyAV CCTTC 1 cut(s) 20
HpyCH4III ACNGT 1 cut(s) 169
HpyCH4V TGCA 1 cut(s) 128
HpyF10VI GCNNNNNNNGC 1 cut(s) 100
Hsp92II CATG 2 cut(s) 98, 121
Kzo9I GATC 3 cut(s) 3, 45, 225
LpnPI CCDG 6 cut(s) 24, 90, 114, 117, 120, 147
MalI GATC 3 cut(s) 5, 47, 227
MboI GATC 3 cut(s) 3, 45, 225
MboII GAAGA 1 cut(s) 196
MfeI CAATTG 1 cut(s) 197
MflI RGATCY 1 cut(s) 225
MluCI AATT 2 cut(s) 65, 197
MlyI GAGTC 1 cut(s) 157
MnlI CCTC 4 cut(s) 5, 35, 204, 230
MseI TTAA 1 cut(s) 158
MspR9I CCNGG 2 cut(s) 105, 135
MunI CAATTG 1 cut(s) 197
MvaI CCWGG 2 cut(s) 105, 135
MwoI GCNNNNNNNGC 1 cut(s) 100
NdeII GATC 3 cut(s) 3, 45, 225
NlaIII CATG 2 cut(s) 98, 121
NlaIV GGNNCC 2 cut(s) 61, 227
NspI RCATGY 1 cut(s) 98
PfeI GAWTC 1 cut(s) 209
PleI GAGTC 1 cut(s) 156
PpsI GAGTC 1 cut(s) 156
Psp6I CCWGG 2 cut(s) 103, 133
PspGI CCWGG 2 cut(s) 103, 133
PspN4I GGNNCC 2 cut(s) 61, 227
PspPI GGNCC 2 cut(s) 101, 131
PsrI GAACNNNNNNTAC 2 cut(s) 43, 75
PstNI CAGNNNCTG 1 cut(s) 134
PsuI RGATCY 1 cut(s) 225
RsaI GTAC 1 cut(s) 139
RsaNI GTAC 1 cut(s) 138
SaqAI TTAA 1 cut(s) 158
Sau3AI GATC 3 cut(s) 3, 45, 225
Sau96I GGNCC 2 cut(s) 101, 131
SchI GAGTC 1 cut(s) 157
ScrFI CCNGG 2 cut(s) 105, 135
SetI ASST 1 cut(s) 83
Sse9I AATT 2 cut(s) 65, 197
StyD4I CCNGG 2 cut(s) 103, 133
StyI CCWWGG 1 cut(s) 7
TaaI ACNGT 1 cut(s) 169
TasI AATT 2 cut(s) 65, 197
TfiI GAWTC 1 cut(s) 209
Tru1I TTAA 1 cut(s) 158
Tru9I TTAA 1 cut(s) 158
TscAI CASTG 1 cut(s) 28
TspDTI ATGAA 1 cut(s) 222
TspRI CASTG 1 cut(s) 28
XapI RAATTY 1 cut(s) 65
XceI RCATGY 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.