Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0010108.1

Orthogroup ID

OG0003361

Physical Location & Seq

Genomic Coordinates Reverse (-)

5758 .. 6245

Gene Structure 488 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0010108.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 387 bp

atggaggatttgaggaattacaaagtgaatgttacggatgccatgactgcaaatgtgttgggatatactatatcaggaatgccacctccttcagctggaactttggggctttctatgattctgaacatcttcaacagctacggaaattcagatgcagcaaacggagatcttggtctgcatcgtctgattgaagcattgaaacacatgtttgcaatccgaatgaacttgggtgatcctgcttttgtagatacccatgaatatgcatctgacatgctttctccatcctttgctatggaaattcagcagaagatatttgacaacacaactttcccactagagtactattcatacaggcatgatcacccaacattttatagtctaaattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0002237 GO:0003674 GO:0003824 GO:0005575 GO:0005576 GO:0005615 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005886 GO:0005887 GO:0006082 GO:0006508 GO:0006518 GO:0006520 GO:0006536 GO:0006575 GO:0006749 GO:0006751 GO:0006790 GO:0006805 GO:0006807 GO:0006950 GO:0006979 GO:0007568 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008242 GO:0009056 GO:0009064 GO:0009410 GO:0009605 GO:0009607 GO:0009617 GO:0009719 GO:0009725 GO:0009987 GO:0010033 GO:0010467 GO:0014070 GO:0016020 GO:0016021 GO:0016485 GO:0016740 GO:0016746 GO:0016755 GO:0016756 GO:0016787 GO:0019538 GO:0019752 GO:0031179 GO:0031224 GO:0031226 GO:0031638 GO:0032355 GO:0032496 GO:0032502 GO:0033554 GO:0033993 GO:0034097 GO:0034599 GO:0034612 GO:0034641 GO:0036374 GO:0042219 GO:0042221 GO:0043170 GO:0043171 GO:0043207 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043436 GO:0043603 GO:0043648 GO:0044237 GO:0044238 GO:0044248 GO:0044273 GO:0044281 GO:0044421 GO:0044424 GO:0044425 GO:0044444 GO:0044459 GO:0044464 GO:0050896 GO:0051186 GO:0051187 GO:0051604 GO:0051704 GO:0051707 GO:0051716 GO:0070011 GO:0070887 GO:0071466 GO:0071704 GO:0071944 GO:0140096 GO:1901564 GO:1901565 GO:1901575 GO:1901605 GO:1901700

KEGG Pathways

Metabolic & Signaling

ko00430 ko00460 ko00480 ko00590 ko01100 map00430 map00460 map00480 map00590 map01100

Pfam Domains

Protein Families

G_glu_transpept

Protein Analysis

128

Amino Acids

14.36

Weight (kDa)

4.91

Isoelectric Point (pI)

39.0

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003361)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G29210 AT4G29210 AT4G39650
fragaria_vesca	FvH4_1g06610 FvH4_1g06610
malus_domestica	MD02G1069100.v1.1 MD15G1200700.v1.1
prunus_persica	Prupe.7G216500_v2.0.a1
pyrus_communis	pycom02g05470 pycom15g17820
rosa_chinensis	RchiOBHm_Chr1g0323641 RchiOBHm_Chr2g0092341 RchiOBHm_Chr2g0139001 RchiOBHm_Chr5g0064951
rosa_laevigata	RLG00000015286 RLG00000016301 RLG00000018659
rosa_multiflora	Rmu_sc0000461.1_g000012 Rmu_sc0000461.1_g000013 Rmu_sc0003289.1_g000009 Rmu_sc0006014.1_g000003 Rmu_sc0006014.1_g000004 Rmu_sc0010108.1_g000002
rosa_roxburghii	Rroxscaffold_3G00249440
rosa_rugosa	Rorug02G0025000 Rorug02G0025100
rosa_samantha	Rh1CG057300 Rh1DG061100 Rh2AG071000 Rh2BG070600 Rh2BG414200 Rh2CG072000 Rh2DG069500
rosa_wichuraiana	Rw0G021800 Rw2G006130 Rw2G032860

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	227
AcsI	RAATTY	2 cut(s)	145, 297
AcuI	CTGAAG	1 cut(s)	75
AfaI	GTAC	1 cut(s)	341
AfiI	CCNNNNNNNGG	1 cut(s)	95
AflIII	ACRYGT	1 cut(s)	204
AgsI	TTSAA	3 cut(s)	133, 191, 199
AluBI	AGCT	2 cut(s)	95, 138
AluI	AGCT	2 cut(s)	95, 138
AlwI	GGATC	1 cut(s)	227
ApeKI	GCWGC	1 cut(s)	155
ApoI	RAATTY	2 cut(s)	145, 297
Asp700I	GAANNNNTTC	1 cut(s)	128
AsuHPI	GGTGA	2 cut(s)	242, 353
BbvI	GCAGC	1 cut(s)	167
BccI	CCATC	1 cut(s)	289
BclI	TGATCA	1 cut(s)	358
BfaI	CTAG	1 cut(s)	335
BglII	AGATCT	1 cut(s)	166
BisI	GCNGC	1 cut(s)	156
BlsI	GCNGC	1 cut(s)	157
BmcAI	AGTACT	1 cut(s)	341
BmsI	GCATC	4 cut(s)	28, 142, 187, 272
Bsc4I	CCNNNNNNNGG	1 cut(s)	95
BseGI	GGATG	2 cut(s)	43, 281
BseLI	CCNNNNNNNGG	1 cut(s)	95
BseXI	GCAGC	1 cut(s)	167
BslI	CCNNNNNNNGG	1 cut(s)	95
BsmI	GAATGC	1 cut(s)	84
Bsp143I	GATC	3 cut(s)	166, 232, 358
BspPI	GGATC	1 cut(s)	227
BssMI	GATC	3 cut(s)	166, 232, 358
BstF5I	GGATG	2 cut(s)	43, 281
BstKTI	GATC	3 cut(s)	169, 235, 361
BstMBI	GATC	3 cut(s)	166, 232, 358
BstMWI	GCNNNNNNNGC	1 cut(s)	47
BstNSI	RCATGY	2 cut(s)	208, 274
BstV1I	GCAGC	1 cut(s)	167
BstX2I	RGATCY	1 cut(s)	166
BstYI	RGATCY	1 cut(s)	166
BtsCI	GGATG	2 cut(s)	43, 281
Csp6I	GTAC	1 cut(s)	340
CviAII	CATG	5 cut(s)	43, 205, 254, 271, 356
CviJI	RGCY	3 cut(s)	95, 109, 138
CviKI_1	RGCY	3 cut(s)	95, 109, 138
CviQI	GTAC	1 cut(s)	340
DpnI	GATC	3 cut(s)	168, 234, 360
DpnII	GATC	3 cut(s)	166, 232, 358
Eco57I	CTGAAG	1 cut(s)	75
EcoT22I	ATGCAT	1 cut(s)	265
FaeI	CATG	5 cut(s)	46, 208, 257, 274, 359
FatI	CATG	5 cut(s)	42, 204, 253, 270, 355
FbaI	TGATCA	1 cut(s)	358
Fnu4HI	GCNGC	1 cut(s)	156
FokI	GGATG	2 cut(s)	50, 268
Fsp4HI	GCNGC	1 cut(s)	156
FspBI	CTAG	1 cut(s)	335
GluI	GCNGC	1 cut(s)	156
Hin1II	CATG	5 cut(s)	46, 208, 257, 274, 359
HinfI	GANTC	1 cut(s)	118
HphI	GGTGA	2 cut(s)	242, 353
Hpy188I	TCNGA	5 cut(s)	123, 151, 186, 218, 268
Hpy188III	TCNNGA	1 cut(s)	75
HpyAV	CCTTC	1 cut(s)	99
HpyCH4V	TGCA	5 cut(s)	50, 155, 178, 212, 263
HpyF10VI	GCNNNNNNNGC	1 cut(s)	47
Hsp92II	CATG	5 cut(s)	46, 208, 257, 274, 359
Ksp22I	TGATCA	1 cut(s)	358
Kzo9I	GATC	3 cut(s)	166, 232, 358
LpnPI	CCDG	4 cut(s)	60, 81, 249, 337
Lsp1109I	GCAGC	1 cut(s)	167
LweI	GCATC	4 cut(s)	28, 142, 187, 272
MaeI	CTAG	1 cut(s)	335
MaeIII	GTNAC	1 cut(s)	31
MalI	GATC	3 cut(s)	168, 234, 360
MboI	GATC	3 cut(s)	166, 232, 358
MboII	GAAGA	2 cut(s)	121, 319
MflI	RGATCY	1 cut(s)	166
MluCI	AATT	4 cut(s)	16, 145, 297, 382
MnlI	CCTC	2 cut(s)	6, 96
Mph1103I	ATGCAT	1 cut(s)	265
MroXI	GAANNNNTTC	1 cut(s)	128
MslI	CAYNNNNRTG	1 cut(s)	258
MspA1I	CMGCKG	1 cut(s)	95
Mva1269I	GAATGC	1 cut(s)	84
MwoI	GCNNNNNNNGC	1 cut(s)	47
NdeII	GATC	3 cut(s)	166, 232, 358
NlaIII	CATG	5 cut(s)	46, 208, 257, 274, 359
NsiI	ATGCAT	1 cut(s)	265
NspI	RCATGY	2 cut(s)	208, 274
PciI	ACATGT	1 cut(s)	204
PctI	GAATGC	1 cut(s)	84
PdmI	GAANNNNTTC	1 cut(s)	128
PfeI	GAWTC	1 cut(s)	118
PkrI	GCNGC	1 cut(s)	157
PscI	ACATGT	1 cut(s)	204
PsuI	RGATCY	1 cut(s)	166
PvuII	CAGCTG	1 cut(s)	95
RsaI	GTAC	1 cut(s)	341
RsaNI	GTAC	1 cut(s)	340
RseI	CAYNNNNRTG	1 cut(s)	258
SatI	GCNGC	1 cut(s)	156
Sau3AI	GATC	3 cut(s)	166, 232, 358
ScaI	AGTACT	1 cut(s)	341
SetI	ASST	3 cut(s)	88, 97, 140
SfaNI	GCATC	4 cut(s)	28, 142, 187, 272
SmiMI	CAYNNNNRTG	1 cut(s)	258
Sse9I	AATT	4 cut(s)	16, 145, 297, 382
SspMI	CTAG	1 cut(s)	335
TasI	AATT	4 cut(s)	16, 145, 297, 382
TatI	WGTACW	1 cut(s)	339
TfiI	GAWTC	1 cut(s)	118
TseI	GCWGC	1 cut(s)	155
TspDTI	ATGAA	3 cut(s)	236, 270, 336
TspGWI	ACGGA	3 cut(s)	50, 156, 177
XapI	RAATTY	2 cut(s)	145, 297
XceI	RCATGY	2 cut(s)	208, 274
XmnI	GAANNNNTTC	1 cut(s)	128
XspI	CTAG	1 cut(s)	335
ZrmI	AGTACT	1 cut(s)	341
Zsp2I	ATGCAT	1 cut(s)	265

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.