Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0010917.1

Orthogroup ID

OG0009727

Physical Location & Seq

Genomic Coordinates Reverse (-)

45648 .. 46304

Gene Structure 657 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0010917.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 264 bp

atgatagcatctggatgtcttttgccaagcttgccttcggatgcaatatttgaaagttcaggggtcagcttcctttgtgatctgaatgataacattccagctccctggcccacctcttctcaaggagcagcttcaacatgcagtaaaggtgtcaagattcctgcacttcctgcagcagcatcagcagaaaggggcaattacaacgatgttgtgatgctttctctgctcgttgcttttgcaatggcccttttgatgttcatgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0005911 GO:0009506 GO:0016020 GO:0030054 GO:0031224 GO:0031225 GO:0031226 GO:0044425 GO:0044459 GO:0044464 GO:0046658 GO:0055044 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

87

Amino Acids

8.97

Weight (kDa)

4.23

Isoelectric Point (pI)

43.36

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009727)

Species	Orthologous Gene IDs
malus_domestica	MD05G1345000.v1.1
rosa_chinensis	RchiOBHm_Chr5g0060961
rosa_laevigata	RLG00000028318 RLG00000032438
rosa_multiflora	Rmu_co8107644.1_g000001 Rmu_co8229399.1_g000001 Rmu_sc0000316.1_g000006 Rmu_sc0000640.1_g000014 Rmu_sc0007627.1_g000004 Rmu_sc0010917.1_g000006
rosa_roxburghii	Rroxscaffold_152G00434550 Rroxscaffold_2G00100700 Rroxscaffold_2G00103070 Rroxscaffold_5G00366020
rosa_samantha	Rh4CG162900 Rh5AG329700 Rh5AG398100 Rh5BG410900 Rh5CG436000 Rh5DG425300 Rh5DG425400 Rh6DG389100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	2 cut(s)	53, 135
AjnI	CCWGG	1 cut(s)	104
AjuI	GAANNNNNNNTTGG	2 cut(s)	19, 51
AluBI	AGCT	4 cut(s)	30, 69, 101, 131
AluI	AGCT	4 cut(s)	30, 69, 101, 131
AoxI	GGCC	2 cut(s)	107, 243
ApeKI	GCWGC	3 cut(s)	128, 173, 176
AspS9I	GGNCC	2 cut(s)	108, 244
BbvI	GCAGC	3 cut(s)	140, 185, 188
BciT130I	CCWGG	1 cut(s)	106
BfmI	CTRYAG	1 cut(s)	171
BisI	GCNGC	3 cut(s)	129, 174, 177
BlsI	GCNGC	3 cut(s)	130, 175, 178
Bme1390I	CCNGG	1 cut(s)	106
BmgT120I	GGNCC	2 cut(s)	108, 244
BmrFI	CCNGG	1 cut(s)	106
BmsI	GCATC	4 cut(s)	17, 31, 188, 204
BpuEI	CTTGAG	1 cut(s)	105
BsaJI	CCNNGG	1 cut(s)	104
Bse3DI	GCAATG	1 cut(s)	246
BseBI	CCWGG	1 cut(s)	106
BseDI	CCNNGG	1 cut(s)	104
BseGI	GGATG	2 cut(s)	20, 46
BseMI	GCAATG	1 cut(s)	246
BseXI	GCAGC	3 cut(s)	140, 185, 188
BsgI	GTGCAG	1 cut(s)	147
BshFI	GGCC	2 cut(s)	109, 245
BsnI	GGCC	2 cut(s)	109, 245
Bsp143I	GATC	1 cut(s)	79
BspANI	GGCC	2 cut(s)	109, 245
BspMAI	CTGCAG	1 cut(s)	175
BsrDI	GCAATG	1 cut(s)	246
BssECI	CCNNGG	1 cut(s)	104
BssMI	GATC	1 cut(s)	79
Bst2UI	CCWGG	1 cut(s)	106
Bst6I	CTCTTC	1 cut(s)	121
BstAPI	GCANNNNNTGC	1 cut(s)	170
BstC8I	GCNNGC	1 cut(s)	32
BstF5I	GGATG	2 cut(s)	20, 46
BstKTI	GATC	1 cut(s)	82
BstMBI	GATC	1 cut(s)	79
BstMWI	GCNNNNNNNGC	4 cut(s)	31, 170, 182, 223
BstNI	CCWGG	1 cut(s)	106
BstNSI	RCATGY	1 cut(s)	141
BstSCI	CCNGG	1 cut(s)	104
BstSFI	CTRYAG	1 cut(s)	171
BstV1I	GCAGC	3 cut(s)	140, 185, 188
BstXI	CCANNNNNNTGG	1 cut(s)	105
BsuRI	GGCC	2 cut(s)	109, 245
BtsCI	GGATG	2 cut(s)	20, 46
Cac8I	GCNNGC	1 cut(s)	32
Cfr13I	GGNCC	2 cut(s)	108, 244
CviAII	CATG	2 cut(s)	138, 259
CviJI	RGCY	6 cut(s)	30, 69, 101, 109, 131, 245
CviKI_1	RGCY	6 cut(s)	30, 69, 101, 109, 131, 245
DpnI	GATC	1 cut(s)	81
DpnII	GATC	1 cut(s)	79
Eam1104I	CTCTTC	1 cut(s)	121
EarI	CTCTTC	1 cut(s)	121
EcoRII	CCWGG	1 cut(s)	104
FaeI	CATG	2 cut(s)	141, 262
FaiI	YATR	2 cut(s)	139, 260
FalI	AAGNNNNNCTT	2 cut(s)	19, 51
FatI	CATG	2 cut(s)	137, 258
Fnu4HI	GCNGC	3 cut(s)	129, 174, 177
FokI	GGATG	2 cut(s)	27, 53
Fsp4HI	GCNGC	3 cut(s)	129, 174, 177
GluI	GCNGC	3 cut(s)	129, 174, 177
HaeIII	GGCC	2 cut(s)	109, 245
Hin1II	CATG	2 cut(s)	141, 262
HindIII	AAGCTT	1 cut(s)	28
HinfI	GANTC	1 cut(s)	157
Hpy188I	TCNGA	2 cut(s)	40, 84
Hpy188III	TCNNGA	2 cut(s)	12, 154
HpyAV	CCTTC	1 cut(s)	45
HpyCH4V	TGCA	5 cut(s)	44, 141, 164, 173, 239
HpyF10VI	GCNNNNNNNGC	4 cut(s)	31, 170, 182, 223
Hsp92II	CATG	2 cut(s)	141, 262
Kzo9I	GATC	1 cut(s)	79
LmnI	GCTCC	2 cut(s)	106, 125
LpnPI	CCDG	6 cut(s)	45, 91, 111, 118, 174, 183
Lsp1109I	GCAGC	3 cut(s)	140, 185, 188
LweI	GCATC	4 cut(s)	17, 31, 188, 204
MalI	GATC	1 cut(s)	81
MboI	GATC	1 cut(s)	79
MboII	GAAGA	1 cut(s)	108
MluCI	AATT	1 cut(s)	196
MnlI	CCTC	1 cut(s)	124
MslI	CAYNNNNRTG	1 cut(s)	13
MspR9I	CCNGG	1 cut(s)	106
MvaI	CCWGG	1 cut(s)	106
MwoI	GCNNNNNNNGC	4 cut(s)	31, 170, 182, 223
NdeII	GATC	1 cut(s)	79
NlaIII	CATG	2 cut(s)	141, 262
NspI	RCATGY	1 cut(s)	141
PfeI	GAWTC	1 cut(s)	157
PkrI	GCNGC	3 cut(s)	130, 175, 178
Psp6I	CCWGG	1 cut(s)	104
PspGI	CCWGG	1 cut(s)	104
PspPI	GGNCC	2 cut(s)	108, 244
PstI	CTGCAG	1 cut(s)	175
RseI	CAYNNNNRTG	1 cut(s)	13
SatI	GCNGC	3 cut(s)	129, 174, 177
Sau3AI	GATC	1 cut(s)	79
Sau96I	GGNCC	2 cut(s)	108, 244
ScrFI	CCNGG	1 cut(s)	106
SetI	ASST	6 cut(s)	32, 71, 103, 116, 133, 151
SfaNI	GCATC	4 cut(s)	17, 31, 188, 204
SfcI	CTRYAG	1 cut(s)	171
SmiMI	CAYNNNNRTG	1 cut(s)	13
SmlI	CTYRAG	1 cut(s)	120
SmoI	CTYRAG	1 cut(s)	120
Sse9I	AATT	1 cut(s)	196
SspI	AATATT	1 cut(s)	48
StyD4I	CCNGG	1 cut(s)	104
TasI	AATT	1 cut(s)	196
TfiI	GAWTC	1 cut(s)	157
TseI	GCWGC	3 cut(s)	128, 173, 176
TspDTI	ATGAA	1 cut(s)	247
XceI	RCATGY	1 cut(s)	141

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.