Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0011066.1

Orthogroup ID

OG0002314

Physical Location & Seq

Genomic Coordinates Forward (+)

4533 .. 5750

Gene Structure 1218 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0011066.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1218 bp

atgaaaggggatgtaagaacacactcgccttcctcttctatcttcgtctacgaatcgcaagacgaagcagtgaagaatgaggaggatctccaacacgaaaagatcagaccatacaccagaaaatgggaaacaaatattatggacaccattgatgagttggatctcattgcaaagaaaaacactctgatcatgaaccatcataaatgtgatgtccaacatgatgttccagcagtgtttttctcaaccgggggctacaccggcaacgtctaccatgaatttaatgatgggataatgccactgtacattacttcccaacatttcaacaagaaggttgtgttcgtcgttcttgaatttcacaattggtgggtcatgaaatattcagacattctttcccatctctcagattatcccttaatagatttccgtactgataagagagttcattgcttccctgaagccattgtcggtttgaaatttcacgatgagctgactgtggattcttcattgatggaaaggaatgcgagcatagtcgagtttcgaaatctcctagacagagcttaccggcctcagatcagaagtctaatgtatgaacatgcaaagctttctgttgttcccaagttgaaaaaaccatcaagaatcaggagaaaagtgcaagagcatccattcaataagccgaagttggttattatatctcgaaatggatcaagggcaataacaaatgagaattttctagtgaaaatggctgagaaagtcgggtttcaagtccaagttttgaggccagatagccagacaatgttagcagagatttattgggctctaaattcgagtgacgtcatgattggggttcatggtgctgccatgacacattttctgttcatgaagcctggttctgtgttcattcaagtcattcctctcggaactgaatgggcagcagaggcatattatggagaacctgcaaagaagcttgggttgaagtacattggataccaaatccttacgaaagagagctcattatatgacaagtatgataaggatgatcctgttcttaaagatccaaggagtgtaaccagaaagggatggcaatacacaaagatgatctatcttgaggatcagacagtgagactacacctcccaagatttcggaagcagttggttggcgcttttgattacaccattgatagattgaatcagcagggtcctaatattcagtcacattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00514 map00514

Pfam Domains

Protein Families

DUF563

Protein Analysis

405

Amino Acids

47.19

Weight (kDa)

8.83

Isoelectric Point (pI)

33.18

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002314)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G41640 AT2G41640 AT2G41640 AT3G57380 AT3G57380 AT3G57380
fragaria_vesca	FvH4_6g23970 FvH4_6g24320
malus_domestica	MD00G1122300.v1.1 MD12G1075400.v1.1 MD12G1075900.v1.1 MD12G1211600.v1.1 MD14G1073900.v1.1 MD14G1074300.v1.1
prunus_persica	Prupe.7G055600_v2.0.a1 Prupe.7G055700_v2.0.a1
pyrus_communis	pycom12g06490 pycom12g06530 pycom14g06320
rosa_chinensis	RchiOBHm_Chr3g0483201 RchiOBHm_Chr3g0483241
rosa_laevigata	RLG00000023295 RLG00000023297 RLG00000023299
rosa_multiflora	Rmu_sc0000058.1_g000002 Rmu_sc0004790.1_g000011 Rmu_sc0007550.1_g000006 Rmu_sc0011066.1_g000001 Rmu_sc0026377.1_g000002
rosa_roxburghii	Rroxscaffold_6G00398530 Rroxscaffold_6G00398550
rosa_rugosa	Rorug03G0204900 Rorug03G0204900
rosa_samantha	Rh3AG253100 Rh3AG253300 Rh3BG290300 Rh3CG287100 Rh3CG287200 Rh3DG282700 Rh3DG282900
rosa_wichuraiana	Rw3G022900 Rw3G022910

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	834
Acc36I	ACCTGC	1 cut(s)	961
AccB7I	CCANNNNNTGG	1 cut(s)	123
AccI	GTMKAC	2 cut(s)	48, 267
AclWI	GGATC	6 cut(s)	93, 168, 709, 1031, 1046, 1116
AcsI	RAATTY	5 cut(s)	275, 350, 473, 724, 820
AcuI	CTGAAG	1 cut(s)	474
AcyI	GRCGYC	1 cut(s)	831
AfaI	GTAC	3 cut(s)	302, 427, 977
AfiI	CCNNNNNNNGG	1 cut(s)	123
AgsI	TTSAA	9 cut(s)	322, 350, 472, 622, 667, 761, 902, 973, 1186
AjnI	CCWGG	1 cut(s)	883
AjuI	GAANNNNNNNTTGG	2 cut(s)	207, 239
AluBI	AGCT	5 cut(s)	487, 557, 601, 964, 1008
AluI	AGCT	5 cut(s)	487, 557, 601, 964, 1008
Alw21I	GWGCWC	1 cut(s)	1010
Alw26I	GTCTC	1 cut(s)	1114
AlwI	GGATC	6 cut(s)	93, 168, 709, 1031, 1046, 1116
AoxI	GGCC	2 cut(s)	563, 776
ApeKI	GCWGC	2 cut(s)	854, 929
ApoI	RAATTY	5 cut(s)	275, 350, 473, 724, 820
AspLEI	GCGC	1 cut(s)	1160
AspS9I	GGNCC	1 cut(s)	1196
AsuC2I	CCSGG	1 cut(s)	247
AsuII	TTCGAA	1 cut(s)	538
AvaII	GGWCC	1 cut(s)	1196
BanII	GRGCYC	2 cut(s)	817, 1010
Bbv12I	GWGCWC	1 cut(s)	1010
BbvI	GCAGC	2 cut(s)	841, 941
BccI	CCATC	6 cut(s)	204, 278, 402, 502, 637, 1071
BciT130I	CCWGG	1 cut(s)	885
BciVI	GTATCC	1 cut(s)	977
BclI	TGATCA	1 cut(s)	186
BcnI	CCSGG	1 cut(s)	247
BcoDI	GTCTC	1 cut(s)	1114
BfaI	CTAG	2 cut(s)	548, 731
BfoI	RGCGCY	1 cut(s)	1161
BfuAI	ACCTGC	1 cut(s)	961
BfuI	GTATCC	1 cut(s)	977
BisI	GCNGC	2 cut(s)	855, 930
BlsI	GCNGC	2 cut(s)	856, 931
Bme1390I	CCNGG	2 cut(s)	247, 885
Bme18I	GGWCC	1 cut(s)	1196
BmgT120I	GGNCC	1 cut(s)	1196
BmiI	GGNNCC	1 cut(s)	1197
BmrFI	CCNGG	2 cut(s)	247, 885
BmsI	GCATC	1 cut(s)	667
Bpu14I	TTCGAA	1 cut(s)	538
BpuEI	CTTGAG	1 cut(s)	1124
BpuMI	CCSGG	1 cut(s)	247
BsaHI	GRCGYC	1 cut(s)	831
BsaJI	CCNNGG	2 cut(s)	246, 1055
BsaXI	ACNNNNNCTCC	2 cut(s)	1113, 1143
Bsc4I	CCNNNNNNNGG	1 cut(s)	123
Bse118I	RCCGGY	2 cut(s)	257, 561
Bse3DI	GCAATG	2 cut(s)	165, 442
BseBI	CCWGG	1 cut(s)	885
BseDI	CCNNGG	2 cut(s)	246, 1055
BseGI	GGATG	4 cut(s)	16, 658, 1039, 1082
BseLI	CCNNNNNNNGG	1 cut(s)	123
BseMI	GCAATG	2 cut(s)	165, 442
BseMII	CTCAG	3 cut(s)	414, 581, 735
BseRI	GAGGAG	1 cut(s)	95
BseXI	GCAGC	2 cut(s)	841, 941
BshFI	GGCC	2 cut(s)	565, 778
BsiHKAI	GWGCWC	1 cut(s)	1010
BsiSI	CCGG	3 cut(s)	246, 258, 562
BslI	CCNNNNNNNGG	1 cut(s)	123
BsmAI	GTCTC	1 cut(s)	1114
BsmI	GAATGC	1 cut(s)	523
BsnI	GGCC	2 cut(s)	565, 778
Bsp119I	TTCGAA	1 cut(s)	538
Bsp1286I	GDGCHC	2 cut(s)	817, 1010
Bsp1407I	TGTACA	1 cut(s)	300
BspANI	GGCC	2 cut(s)	565, 778
BspCNI	CTCAG	3 cut(s)	413, 580, 736
BspHI	TCATGA	4 cut(s)	189, 369, 834, 876
BspLI	GGNNCC	1 cut(s)	1197
BspMI	ACCTGC	1 cut(s)	961
BspPI	GGATC	6 cut(s)	93, 168, 709, 1031, 1046, 1116
BspT104I	TTCGAA	1 cut(s)	538
BsrDI	GCAATG	2 cut(s)	165, 442
BsrFI	RCCGGY	2 cut(s)	257, 561
BsrGI	TGTACA	1 cut(s)	300
BssAI	RCCGGY	2 cut(s)	257, 561
BssECI	CCNNGG	2 cut(s)	246, 1055
BssNI	GRCGYC	1 cut(s)	831
BssT1I	CCWWGG	1 cut(s)	1055
Bst2UI	CCWGG	1 cut(s)	885
Bst4CI	ACNGT	3 cut(s)	300, 493, 1117
Bst6I	CTCTTC	1 cut(s)	40
BstACI	GRCGYC	1 cut(s)	831
BstAUI	TGTACA	1 cut(s)	300
BstBI	TTCGAA	1 cut(s)	538
BstC8I	GCNNGC	1 cut(s)	523
BstDEI	CTNAG	3 cut(s)	400, 567, 744
BstF5I	GGATG	4 cut(s)	16, 658, 1039, 1082
BstH2I	RGCGCY	1 cut(s)	1161
BstHHI	GCGC	1 cut(s)	1160
BstMAI	GTCTC	1 cut(s)	1114
BstMWI	GCNNNNNNNGC	2 cut(s)	258, 935
BstNI	CCWGG	1 cut(s)	885
BstNSI	RCATGY	1 cut(s)	596
BstSCI	CCNGG	2 cut(s)	245, 883
BstV1I	GCAGC	2 cut(s)	841, 941
BstX2I	RGATCY	3 cut(s)	85, 160, 1051
BstYI	RGATCY	3 cut(s)	85, 160, 1051
BsuI	GTATCC	1 cut(s)	977
BsuRI	GGCC	2 cut(s)	565, 778
BtsCI	GGATG	4 cut(s)	16, 658, 1039, 1082
BtsI	GCAGTG	2 cut(s)	75, 237
BtsIMutI	CAGTG	4 cut(s)	75, 237, 296, 1122
BveI	ACCTGC	1 cut(s)	961
Cac8I	GCNNGC	1 cut(s)	523
CciI	TCATGA	4 cut(s)	189, 369, 834, 876
CfoI	GCGC	1 cut(s)	1160
Cfr10I	RCCGGY	2 cut(s)	257, 561
Cfr13I	GGNCC	1 cut(s)	1196
Csp6I	GTAC	3 cut(s)	301, 426, 976
CviAII	CATG	9 cut(s)	190, 218, 272, 370, 593, 835, 848, 859, 877
CviQI	GTAC	3 cut(s)	301, 426, 976
DdeI	CTNAG	3 cut(s)	400, 567, 744
Eam1104I	CTCTTC	1 cut(s)	40
EarI	CTCTTC	1 cut(s)	40
Ecl136II	GAGCTC	1 cut(s)	1008
Eco130I	CCWWGG	1 cut(s)	1055
Eco24I	GRGCYC	2 cut(s)	817, 1010
Eco47I	GGWCC	1 cut(s)	1196
Eco53kI	GAGCTC	1 cut(s)	1008
Eco57I	CTGAAG	1 cut(s)	474
EcoICRI	GAGCTC	1 cut(s)	1008
EcoO109I	RGGNCCY	1 cut(s)	1196
EcoRII	CCWGG	1 cut(s)	883
EcoT14I	CCWWGG	1 cut(s)	1055
EcoT38I	GRGCYC	2 cut(s)	817, 1010
ErhI	CCWWGG	1 cut(s)	1055
FaeI	CATG	9 cut(s)	193, 221, 275, 373, 596, 838, 851, 862, 880
FatI	CATG	9 cut(s)	189, 217, 271, 369, 592, 834, 847, 858, 876
FbaI	TGATCA	1 cut(s)	186
FblI	GTMKAC	2 cut(s)	48, 267
Fnu4HI	GCNGC	2 cut(s)	855, 930
FokI	GGATG	4 cut(s)	23, 645, 1046, 1089
FriOI	GRGCYC	2 cut(s)	817, 1010
Fsp4HI	GCNGC	2 cut(s)	855, 930
FspBI	CTAG	2 cut(s)	548, 731
GlaI	GCGC	1 cut(s)	1159
GluI	GCNGC	2 cut(s)	855, 930
HaeII	RGCGCY	1 cut(s)	1161
HaeIII	GGCC	2 cut(s)	565, 778
HapII	CCGG	3 cut(s)	246, 258, 562
HhaI	GCGC	1 cut(s)	1160
Hin1I	GRCGYC	1 cut(s)	831
Hin1II	CATG	9 cut(s)	193, 221, 275, 373, 596, 838, 851, 862, 880
Hin6I	GCGC	1 cut(s)	1158
HinP1I	GCGC	1 cut(s)	1158
HindIII	AAGCTT	2 cut(s)	599, 962
HinfI	GANTC	4 cut(s)	53, 497, 636, 1186
HpaII	CCGG	3 cut(s)	246, 258, 562
Hpy166II	GTNNAC	2 cut(s)	49, 268
Hpy188I	TCNGA	9 cut(s)	107, 186, 382, 403, 570, 575, 917, 1113, 1143
Hpy8I	GTNNAC	2 cut(s)	49, 268
Hpy99I	CGWCG	1 cut(s)	344
HpyAV	CCTTC	2 cut(s)	39, 322
HpyCH4III	ACNGT	3 cut(s)	300, 493, 1117
HpyCH4IV	ACGT	2 cut(s)	264, 831
HpyCH4V	TGCA	4 cut(s)	170, 596, 652, 956
HpyF10VI	GCNNNNNNNGC	2 cut(s)	258, 935
HpyF3I	CTNAG	3 cut(s)	400, 567, 744
HpySE526I	ACGT	2 cut(s)	264, 831
Hsp92I	GRCGYC	1 cut(s)	831
Hsp92II	CATG	9 cut(s)	193, 221, 275, 373, 596, 838, 851, 862, 880
HspAI	GCGC	1 cut(s)	1158
Ksp22I	TGATCA	1 cut(s)	186
Lsp1109I	GCAGC	2 cut(s)	841, 941
LweI	GCATC	1 cut(s)	667
MaeI	CTAG	2 cut(s)	548, 731
MaeII	ACGT	2 cut(s)	264, 831
MaeIII	GTNAC	3 cut(s)	827, 1063, 1209
MboII	GAAGA	4 cut(s)	27, 34, 85, 492
MfeI	CAATTG	1 cut(s)	358
MflI	RGATCY	3 cut(s)	85, 160, 1051
MhlI	GDGCHC	2 cut(s)	817, 1010
MluCI	AATT	6 cut(s)	275, 350, 358, 473, 724, 820
MmeI	TCCRAC	3 cut(s)	115, 138, 238
MnlI	CCTC	9 cut(s)	43, 73, 76, 576, 768, 921, 928, 1099, 1139
MseI	TTAA	3 cut(s)	279, 413, 1047
MslI	CAYNNNNRTG	2 cut(s)	204, 1091
MspI	CCGG	3 cut(s)	246, 258, 562
MspR9I	CCNGG	2 cut(s)	247, 885
MunI	CAATTG	1 cut(s)	358
Mva1269I	GAATGC	1 cut(s)	523
MvaI	CCWGG	1 cut(s)	885
MwoI	GCNNNNNNNGC	2 cut(s)	258, 935
NciI	CCSGG	1 cut(s)	247
NlaIII	CATG	9 cut(s)	193, 221, 275, 373, 596, 838, 851, 862, 880
NlaIV	GGNNCC	1 cut(s)	1197
NmuCI	GTSAC	2 cut(s)	827, 1209
NspI	RCATGY	1 cut(s)	596
NspV	TTCGAA	1 cut(s)	538
PagI	TCATGA	4 cut(s)	189, 369, 834, 876
PctI	GAATGC	1 cut(s)	523
PfeI	GAWTC	4 cut(s)	53, 497, 636, 1186
PflMI	CCANNNNNTGG	1 cut(s)	123
PkrI	GCNGC	2 cut(s)	856, 931
PpuMI	RGGWCCY	1 cut(s)	1196
Psp124BI	GAGCTC	1 cut(s)	1010
Psp5II	RGGWCCY	1 cut(s)	1196
Psp6I	CCWGG	1 cut(s)	883
PspGI	CCWGG	1 cut(s)	883
PspN4I	GGNNCC	1 cut(s)	1197
PspPI	GGNCC	1 cut(s)	1196
PspPPI	RGGWCCY	1 cut(s)	1196
PsuI	RGATCY	3 cut(s)	85, 160, 1051
RsaI	GTAC	3 cut(s)	302, 427, 977
RsaNI	GTAC	3 cut(s)	301, 426, 976
RseI	CAYNNNNRTG	2 cut(s)	204, 1091
SacI	GAGCTC	1 cut(s)	1010
SaqAI	TTAA	3 cut(s)	279, 413, 1047
SatI	GCNGC	2 cut(s)	855, 930
Sau96I	GGNCC	1 cut(s)	1196
ScrFI	CCNGG	2 cut(s)	247, 885
SduI	GDGCHC	2 cut(s)	817, 1010
SfaNI	GCATC	1 cut(s)	667
SfuI	TTCGAA	1 cut(s)	538
SinI	GGWCC	1 cut(s)	1196
SmiMI	CAYNNNNRTG	2 cut(s)	204, 1091
SmlI	CTYRAG	1 cut(s)	1103
SmoI	CTYRAG	1 cut(s)	1103
Sse9I	AATT	6 cut(s)	275, 350, 358, 473, 724, 820
SspI	AATATT	3 cut(s)	136, 377, 1204
SspMI	CTAG	2 cut(s)	548, 731
SstI	GAGCTC	1 cut(s)	1010
StyD4I	CCNGG	2 cut(s)	245, 883
StyI	CCWWGG	1 cut(s)	1055
TaaI	ACNGT	3 cut(s)	300, 493, 1117
TaiI	ACGT	2 cut(s)	267, 834
TaqI	TCGA	4 cut(s)	531, 538, 694, 824
TasI	AATT	6 cut(s)	275, 350, 358, 473, 724, 820
TatI	WGTACW	2 cut(s)	300, 975
TfiI	GAWTC	4 cut(s)	53, 497, 636, 1186
Tru1I	TTAA	3 cut(s)	279, 413, 1047
Tru9I	TTAA	3 cut(s)	279, 413, 1047
TscAI	CASTG	4 cut(s)	75, 237, 303, 1122
TseFI	GTSAC	2 cut(s)	827, 1209
TseI	GCWGC	2 cut(s)	854, 929
Tsp45I	GTSAC	2 cut(s)	827, 1209
TspGWI	ACGGA	1 cut(s)	413
TspRI	CASTG	4 cut(s)	75, 237, 303, 1122
Van91I	CCANNNNNTGG	1 cut(s)	123
VpaK11BI	GGWCC	1 cut(s)	1196
XapI	RAATTY	5 cut(s)	275, 350, 473, 724, 820
XceI	RCATGY	1 cut(s)	596
XcmI	CCANNNNNNNNNTGG	1 cut(s)	154
XmiI	GTMKAC	2 cut(s)	48, 267
XspI	CTAG	2 cut(s)	548, 731
ZraI	GACGTC	1 cut(s)	832

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.