Rmu_sc0011139.1_g000001

Belongs to the glycosyl hydrolase 1 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011139.1
Physical Location & Seq
Forward (+)
1 .. 1723
1723 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011139.1_g000001.1.cds

Sequence Viewer

Length: 283 bp
caagcattttcgggactatgcggagctgtgttacaaggaatttggtgatcgggtaaagcactggatcacgttgagtgagccatgtacatacagtagtggtggttatgcaggtgggtcattggcaccaggaccgtgttctgcgtggcagcagctaaattgcaccggcggggattcgggtactgaaccatatttggtggcacaccacctactcttatctcatgcagctgctgtaaagttgtacaagcagaaatgcactagaatttcccgaatatcaggtcaatag

Protein Analysis

93

Amino Acids

10.22

Weight (kDa)

8.65

Isoelectric Point (pI)

41.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 99
Acc36I ACCTGC 1 cut(s) 99
AccB1I GGYRCC 1 cut(s) 122
AciI CCGC 2 cut(s) 21, 166
AclWI GGATC 1 cut(s) 72
AcsI RAATTY 2 cut(s) 39, 259
AfaI GTAC 3 cut(s) 86, 179, 240
AjnI CCWGG 1 cut(s) 125
AluBI AGCT 3 cut(s) 26, 152, 225
AluI AGCT 3 cut(s) 26, 152, 225
AlwI GGATC 1 cut(s) 72
AlwNI CAGNNNCTG 1 cut(s) 228
ApeKI GCWGC 4 cut(s) 146, 149, 222, 225
ApoI RAATTY 2 cut(s) 39, 259
ArsI GACNNNNNNTTYG 1 cut(s) 260
AspS9I GGNCC 1 cut(s) 129
AsuHPI GGTGA 1 cut(s) 57
AvaII GGWCC 1 cut(s) 129
BanI GGYRCC 1 cut(s) 122
BbvI GCAGC 4 cut(s) 158, 161, 212, 234
BciT130I CCWGG 1 cut(s) 127
BfaI CTAG 1 cut(s) 256
BfuAI ACCTGC 1 cut(s) 99
BisI GCNGC 4 cut(s) 147, 150, 223, 226
BlsI GCNGC 4 cut(s) 148, 151, 224, 227
Bme1390I CCNGG 1 cut(s) 127
Bme18I GGWCC 1 cut(s) 129
BmgT120I GGNCC 1 cut(s) 129
BmiI GGNNCC 1 cut(s) 124
BmrFI CCNGG 1 cut(s) 127
Bse118I RCCGGY 1 cut(s) 162
Bse1I ACTGG 1 cut(s) 66
BseBI CCWGG 1 cut(s) 127
BseNI ACTGG 1 cut(s) 66
BseXI GCAGC 4 cut(s) 158, 161, 212, 234
BshNI GGYRCC 1 cut(s) 122
BsiSI CCGG 1 cut(s) 163
BslFI GGGAC 1 cut(s) 27
BsmFI GGGAC 1 cut(s) 27
Bsp1407I TGTACA 2 cut(s) 84, 238
Bsp143I GATC 2 cut(s) 47, 64
BspACI CCGC 2 cut(s) 21, 166
BspLI GGNNCC 1 cut(s) 124
BspMI ACCTGC 1 cut(s) 99
BspPI GGATC 1 cut(s) 72
BspT107I GGYRCC 1 cut(s) 122
BsrFI RCCGGY 1 cut(s) 162
BsrGI TGTACA 2 cut(s) 84, 238
BsrI ACTGG 1 cut(s) 66
BssAI RCCGGY 1 cut(s) 162
BssMI GATC 2 cut(s) 47, 64
Bst2UI CCWGG 1 cut(s) 127
Bst4CI ACNGT 2 cut(s) 93, 133
BstAUI TGTACA 2 cut(s) 84, 238
BstKTI GATC 2 cut(s) 50, 67
BstMBI GATC 2 cut(s) 47, 64
BstNI CCWGG 1 cut(s) 127
BstSCI CCNGG 1 cut(s) 125
BstV1I GCAGC 4 cut(s) 158, 161, 212, 234
BtsIMutI CAGTG 1 cut(s) 59
BveI ACCTGC 1 cut(s) 99
CaiI CAGNNNCTG 1 cut(s) 228
Cfr10I RCCGGY 1 cut(s) 162
Cfr13I GGNCC 1 cut(s) 129
Csp6I GTAC 3 cut(s) 85, 178, 239
CviAII CATG 2 cut(s) 82, 219
CviJI RGCY 4 cut(s) 26, 80, 152, 225
CviKI_1 RGCY 4 cut(s) 26, 80, 152, 225
CviQI GTAC 3 cut(s) 85, 178, 239
DpnI GATC 2 cut(s) 49, 66
DpnII GATC 2 cut(s) 47, 64
Eco47I GGWCC 1 cut(s) 129
EcoRII CCWGG 1 cut(s) 125
FaeI CATG 2 cut(s) 85, 222
FaiI YATR 6 cut(s) 19, 83, 89, 106, 188, 220
FaqI GGGAC 1 cut(s) 27
FatI CATG 2 cut(s) 81, 218
FauI CCCGC 1 cut(s) 159
Fnu4HI GCNGC 4 cut(s) 147, 150, 223, 226
Fsp4HI GCNGC 4 cut(s) 147, 150, 223, 226
FspBI CTAG 1 cut(s) 256
GluI GCNGC 4 cut(s) 147, 150, 223, 226
HapII CCGG 1 cut(s) 163
Hin1II CATG 2 cut(s) 85, 222
HinfI GANTC 1 cut(s) 171
HpaII CCGG 1 cut(s) 163
HphI GGTGA 1 cut(s) 57
Hpy188III TCNNGA 2 cut(s) 12, 265
HpyCH4III ACNGT 2 cut(s) 93, 133
HpyCH4IV ACGT 1 cut(s) 69
HpyCH4V TGCA 4 cut(s) 108, 160, 222, 253
HpySE526I ACGT 1 cut(s) 69
Hsp92II CATG 2 cut(s) 85, 222
Kzo9I GATC 2 cut(s) 47, 64
LmnI GCTCC 1 cut(s) 23
LpnPI CCDG 6 cut(s) 47, 94, 112, 139, 176, 259
Lsp1109I GCAGC 4 cut(s) 158, 161, 212, 234
MaeI CTAG 1 cut(s) 256
MaeII ACGT 1 cut(s) 69
MaeIII GTNAC 1 cut(s) 30
MalI GATC 2 cut(s) 49, 66
MboI GATC 2 cut(s) 47, 64
MluCI AATT 3 cut(s) 39, 155, 259
MspA1I CMGCKG 1 cut(s) 225
MspI CCGG 1 cut(s) 163
MspR9I CCNGG 1 cut(s) 127
MvaI CCWGG 1 cut(s) 127
NdeII GATC 2 cut(s) 47, 64
NlaIII CATG 2 cut(s) 85, 222
NlaIV GGNNCC 1 cut(s) 124
PaqCI CACCTGC 1 cut(s) 99
PfeI GAWTC 1 cut(s) 171
PkrI GCNGC 4 cut(s) 148, 151, 224, 227
Psp6I CCWGG 1 cut(s) 125
PspGI CCWGG 1 cut(s) 125
PspN4I GGNNCC 1 cut(s) 124
PspPI GGNCC 1 cut(s) 129
PstNI CAGNNNCTG 1 cut(s) 228
PvuII CAGCTG 1 cut(s) 225
RsaI GTAC 3 cut(s) 86, 179, 240
RsaNI GTAC 3 cut(s) 85, 178, 239
SatI GCNGC 4 cut(s) 147, 150, 223, 226
Sau3AI GATC 2 cut(s) 47, 64
Sau96I GGNCC 1 cut(s) 129
ScrFI CCNGG 1 cut(s) 127
SetI ASST 7 cut(s) 28, 72, 113, 154, 208, 227, 278
SgrAI CRCCGGYG 1 cut(s) 162
SinI GGWCC 1 cut(s) 129
Sse9I AATT 3 cut(s) 39, 155, 259
SsiI CCGC 2 cut(s) 21, 166
SspMI CTAG 1 cut(s) 256
StyD4I CCNGG 1 cut(s) 125
TaaI ACNGT 2 cut(s) 93, 133
TaiI ACGT 1 cut(s) 72
TasI AATT 3 cut(s) 39, 155, 259
TatI WGTACW 2 cut(s) 84, 238
TfiI GAWTC 1 cut(s) 171
TscAI CASTG 1 cut(s) 66
TseI GCWGC 4 cut(s) 146, 149, 222, 225
TspRI CASTG 1 cut(s) 66
VpaK11BI GGWCC 1 cut(s) 129
XapI RAATTY 2 cut(s) 39, 259
XspI CTAG 1 cut(s) 256
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.