Rmu_sc0020506.1_g000001

Belongs to the MIP aquaporin (TC 1.A.8) family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020506.1
Physical Location & Seq
Forward (+)
2411 .. 2884
474 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020506.1_g000001.1.cds

Sequence Viewer

Length: 267 bp
atggcagagaatcttgcaaccaatggaagccatgtgattgctgaggtgttggggacatactttatgatattgacgggttgtgggtctgtggtggtgaatttgaacacagaaaatgcggtgtcgtttccagggattgcaataacttggggactggttgtgatggtcttgatttactctgttggtcacatctctggtgctcatttcaatcctgctgtcactattgcttttgctaccaccaagagatttccatggaaacaggtgagctaa

Protein Analysis

88

Amino Acids

9.35

Weight (kDa)

6.81

Isoelectric Point (pI)

16.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 116
AcsI RAATTY 1 cut(s) 97
AgsI TTSAA 2 cut(s) 103, 205
AjnI CCWGG 1 cut(s) 127
AluBI AGCT 1 cut(s) 264
AluI AGCT 1 cut(s) 264
Alw21I GWGCWC 1 cut(s) 199
ApoI RAATTY 1 cut(s) 97
AsuHPI GGTGA 1 cut(s) 106
Bbv12I GWGCWC 1 cut(s) 199
BbvCI CCTCAGC 1 cut(s) 42
BccI CCATC 1 cut(s) 154
BciT130I CCWGG 1 cut(s) 129
Bme1390I CCNGG 1 cut(s) 129
BmrFI CCNGG 1 cut(s) 129
Bpu10I CCTNAGC 1 cut(s) 42
BsaJI CCNNGG 2 cut(s) 128, 248
Bse1I ACTGG 1 cut(s) 156
BseBI CCWGG 1 cut(s) 129
BseDI CCNNGG 2 cut(s) 128, 248
BseMII CTCAG 1 cut(s) 33
BseNI ACTGG 1 cut(s) 156
BsiHKAI GWGCWC 1 cut(s) 199
BslFI GGGAC 2 cut(s) 67, 162
BsmFI GGGAC 2 cut(s) 67, 162
Bsp1286I GDGCHC 1 cut(s) 199
Bsp19I CCATGG 1 cut(s) 248
BspACI CCGC 1 cut(s) 116
BspCNI CTCAG 1 cut(s) 34
BsrI ACTGG 1 cut(s) 156
BssECI CCNNGG 2 cut(s) 128, 248
BssT1I CCWWGG 1 cut(s) 248
Bst2UI CCWGG 1 cut(s) 129
BstDEI CTNAG 1 cut(s) 42
BstDSI CCRYGG 1 cut(s) 248
BstNI CCWGG 1 cut(s) 129
BstSCI CCNGG 1 cut(s) 127
BtgI CCRYGG 1 cut(s) 248
CviAII CATG 2 cut(s) 32, 249
CviJI RGCY 2 cut(s) 30, 264
CviKI_1 RGCY 2 cut(s) 30, 264
DdeI CTNAG 1 cut(s) 42
Eco130I CCWWGG 1 cut(s) 248
EcoRII CCWGG 1 cut(s) 127
EcoT14I CCWWGG 1 cut(s) 248
ErhI CCWWGG 1 cut(s) 248
FaeI CATG 2 cut(s) 35, 252
FaiI YATR 4 cut(s) 33, 58, 65, 250
FaqI GGGAC 2 cut(s) 67, 162
FatI CATG 2 cut(s) 31, 248
Hin1II CATG 2 cut(s) 35, 252
HinfI GANTC 1 cut(s) 10
HphI GGTGA 1 cut(s) 106
Hpy188III TCNNGA 1 cut(s) 166
HpyCH4V TGCA 2 cut(s) 17, 137
HpyF3I CTNAG 1 cut(s) 42
Hsp92II CATG 2 cut(s) 35, 252
LpnPI CCDG 6 cut(s) 114, 137, 141, 177, 222, 242
MaeIII GTNAC 2 cut(s) 182, 214
MhlI GDGCHC 1 cut(s) 199
MluCI AATT 1 cut(s) 97
MnlI CCTC 1 cut(s) 37
MspR9I CCNGG 1 cut(s) 129
MvaI CCWGG 1 cut(s) 129
NcoI CCATGG 1 cut(s) 248
NlaIII CATG 2 cut(s) 35, 252
NmuCI GTSAC 2 cut(s) 182, 214
PfeI GAWTC 1 cut(s) 10
Psp6I CCWGG 1 cut(s) 127
PspGI CCWGG 1 cut(s) 127
ScrFI CCNGG 1 cut(s) 129
SduI GDGCHC 1 cut(s) 199
SetI ASST 3 cut(s) 48, 261, 266
Sse9I AATT 1 cut(s) 97
SsiI CCGC 1 cut(s) 116
StyD4I CCNGG 1 cut(s) 127
StyI CCWWGG 1 cut(s) 248
TasI AATT 1 cut(s) 97
TfiI GAWTC 1 cut(s) 10
TseFI GTSAC 2 cut(s) 182, 214
Tsp45I GTSAC 2 cut(s) 182, 214
XapI RAATTY 1 cut(s) 97
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.