Rmu_sc0035447.1_g000001

L-ascorbate oxidase homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0035447.1
Physical Location & Seq
Reverse (-)
2 .. 487
486 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0035447.1_g000001.1.cds

Sequence Viewer

Length: 486 bp
atgaccatgaaattgctgctgttgtgcctctcgattggcgtaatctcagttgttcatggtgaggatccttaccttttcttcacatggaatgtaacctatggaaccatctctcccctaggagtcccccagcaaggcattctcatcaacggcgagtttccgggacctaacattaactccaccaccaacaacaacatcgtcatcaatgtcttcaacaaccttgatgaaccattgatgttcacatggaatggaatccaacagaagaagaattcatggcaagatggaacaccagggactatgtgccctattcctcctggtcagaactacacataccacttccaagtgaaggaccagattggaagctatttctactatcccatcactgccatgcacagagcaggtggtgccttgccagtgctgccaggcctaaccctcaaggctcctatcactatggtgccatcaacatcacccgcaccatcaagctcgtca
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

162

Amino Acids

17.68

Weight (kDa)

6.23

Isoelectric Point (pI)

45.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 386
Acc36I ACCTGC 1 cut(s) 386
AccB1I GGYRCC 2 cut(s) 401, 451
AciI CCGC 1 cut(s) 468
AclWI GGATC 2 cut(s) 59, 72
AcsI RAATTY 1 cut(s) 265
AfiI CCNNNNNNNGG 2 cut(s) 131, 343
AgsI TTSAA 1 cut(s) 211
AjnI CCWGG 3 cut(s) 286, 310, 418
AleI CACNNNNGTG 1 cut(s) 449
AloI GAACNNNNNNTCC 2 cut(s) 94, 126
AluBI AGCT 2 cut(s) 360, 480
AluI AGCT 2 cut(s) 360, 480
AlwI GGATC 2 cut(s) 59, 72
AoxI GGCC 1 cut(s) 421
ApeKI GCWGC 2 cut(s) 16, 415
ApoI RAATTY 1 cut(s) 265
AspA2I CCTAGG 1 cut(s) 115
AspS9I GGNCC 2 cut(s) 161, 346
AsuC2I CCSGG 1 cut(s) 159
AsuHPI GGTGA 2 cut(s) 71, 456
AvaII GGWCC 2 cut(s) 161, 346
AvrII CCTAGG 1 cut(s) 115
BaeGI GKGCMC 1 cut(s) 302
BamHI GGATCC 1 cut(s) 64
BanI GGYRCC 2 cut(s) 401, 451
BbsI GAAGAC 1 cut(s) 199
BbvI GCAGC 2 cut(s) 3, 402
BccI CCATC 5 cut(s) 113, 272, 383, 463, 481
BceAI ACGGC 1 cut(s) 163
BciT130I CCWGG 3 cut(s) 288, 312, 420
BcnI CCSGG 1 cut(s) 159
BfaI CTAG 1 cut(s) 116
BfuAI ACCTGC 1 cut(s) 386
BisI GCNGC 2 cut(s) 17, 416
BlnI CCTAGG 1 cut(s) 115
BlsI GCNGC 2 cut(s) 18, 417
Bme1390I CCNGG 4 cut(s) 159, 288, 312, 420
Bme18I GGWCC 2 cut(s) 161, 346
BmgT120I GGNCC 2 cut(s) 161, 346
BmiI GGNNCC 6 cut(s) 66, 103, 162, 403, 438, 453
BmrFI CCNGG 4 cut(s) 159, 288, 312, 420
BpiI GAAGAC 1 cut(s) 199
BpuEI CTTGAG 1 cut(s) 416
BpuMI CCSGG 1 cut(s) 159
BsaJI CCNNGG 2 cut(s) 115, 287
BsaXI ACNNNNNCTCC 4 cut(s) 94, 124, 158, 188
Bsc4I CCNNNNNNNGG 2 cut(s) 131, 343
Bse1I ACTGG 1 cut(s) 410
BseBI CCWGG 3 cut(s) 288, 312, 420
BseDI CCNNGG 2 cut(s) 115, 287
BseLI CCNNNNNNNGG 2 cut(s) 131, 343
BseMII CTCAG 1 cut(s) 60
BseNI ACTGG 1 cut(s) 410
BseSI GKGCMC 1 cut(s) 302
BseXI GCAGC 2 cut(s) 3, 402
BseYI CCCAGC 1 cut(s) 126
BshFI GGCC 1 cut(s) 423
BshNI GGYRCC 2 cut(s) 401, 451
BsiSI CCGG 1 cut(s) 158
BslFI GGGAC 3 cut(s) 107, 174, 304
BslI CCNNNNNNNGG 2 cut(s) 131, 343
BsmFI GGGAC 3 cut(s) 107, 174, 304
BsmI GAATGC 1 cut(s) 135
BsnI GGCC 1 cut(s) 423
Bsp1286I GDGCHC 1 cut(s) 302
Bsp143I GATC 1 cut(s) 64
BspACI CCGC 1 cut(s) 468
BspANI GGCC 1 cut(s) 423
BspCNI CTCAG 1 cut(s) 59
BspLI GGNNCC 6 cut(s) 66, 103, 162, 403, 438, 453
BspMI ACCTGC 1 cut(s) 386
BspPI GGATC 2 cut(s) 59, 72
BspT107I GGYRCC 2 cut(s) 401, 451
BsrI ACTGG 1 cut(s) 410
BssECI CCNNGG 2 cut(s) 115, 287
BssMI GATC 1 cut(s) 64
BssT1I CCWWGG 1 cut(s) 115
Bst2UI CCWGG 3 cut(s) 288, 312, 420
BstAPI GCANNNNNTGC 1 cut(s) 401
BstDEI CTNAG 1 cut(s) 46
BstKTI GATC 1 cut(s) 67
BstMBI GATC 1 cut(s) 64
BstMWI GCNNNNNNNGC 2 cut(s) 401, 415
BstNI CCWGG 3 cut(s) 288, 312, 420
BstSCI CCNGG 4 cut(s) 157, 286, 310, 418
BstSLI GKGCMC 1 cut(s) 302
BstV1I GCAGC 2 cut(s) 3, 402
BstV2I GAAGAC 1 cut(s) 199
BstX2I RGATCY 1 cut(s) 64
BstYI RGATCY 1 cut(s) 64
BsuRI GGCC 1 cut(s) 423
BtsI GCAGTG 1 cut(s) 378
BtsIMutI CAGTG 2 cut(s) 378, 417
BveI ACCTGC 1 cut(s) 386
Cfr13I GGNCC 2 cut(s) 161, 346
CviAII CATG 6 cut(s) 7, 56, 84, 240, 270, 385
CviJI RGCY 4 cut(s) 360, 423, 437, 480
CviKI_1 RGCY 4 cut(s) 360, 423, 437, 480
DdeI CTNAG 1 cut(s) 46
DpnI GATC 1 cut(s) 66
DpnII GATC 1 cut(s) 64
Eco130I CCWWGG 1 cut(s) 115
Eco147I AGGCCT 1 cut(s) 423
Eco47I GGWCC 2 cut(s) 161, 346
EcoO109I RGGNCCY 1 cut(s) 161
EcoRI GAATTC 1 cut(s) 265
EcoRII CCWGG 3 cut(s) 286, 310, 418
EcoT14I CCWWGG 1 cut(s) 115
ErhI CCWWGG 1 cut(s) 115
FaeI CATG 6 cut(s) 10, 59, 87, 243, 273, 388
FaqI GGGAC 3 cut(s) 107, 174, 304
FatI CATG 6 cut(s) 6, 55, 83, 239, 269, 384
FauI CCCGC 1 cut(s) 475
Fnu4HI GCNGC 2 cut(s) 17, 416
Fsp4HI GCNGC 2 cut(s) 17, 416
FspBI CTAG 1 cut(s) 116
GluI GCNGC 2 cut(s) 17, 416
GsaI CCCAGC 1 cut(s) 130
HaeIII GGCC 1 cut(s) 423
HapII CCGG 1 cut(s) 158
Hin1II CATG 6 cut(s) 10, 59, 87, 243, 273, 388
HinfI GANTC 2 cut(s) 120, 249
HpaII CCGG 1 cut(s) 158
HphI GGTGA 2 cut(s) 71, 456
Hpy166II GTNNAC 1 cut(s) 237
Hpy188I TCNGA 1 cut(s) 318
Hpy188III TCNNGA 1 cut(s) 31
Hpy8I GTNNAC 1 cut(s) 237
HpyAV CCTTC 1 cut(s) 337
HpyCH4V TGCA 1 cut(s) 388
HpyF10VI GCNNNNNNNGC 2 cut(s) 401, 415
HpyF3I CTNAG 1 cut(s) 46
Hsp92II CATG 6 cut(s) 10, 59, 87, 243, 273, 388
Kzo9I GATC 1 cut(s) 64
LmnI GCTCC 1 cut(s) 442
Lsp1109I GCAGC 2 cut(s) 3, 402
MaeI CTAG 1 cut(s) 116
MaeIII GTNAC 1 cut(s) 91
MalI GATC 1 cut(s) 66
MboI GATC 1 cut(s) 64
MboII GAAGA 4 cut(s) 70, 199, 271, 274
MflI RGATCY 1 cut(s) 64
MhlI GDGCHC 1 cut(s) 302
MluCI AATT 2 cut(s) 11, 265
MlyI GAGTC 1 cut(s) 129
MmeI TCCRAC 1 cut(s) 277
MnlI CCTC 4 cut(s) 38, 55, 318, 440
MseI TTAA 1 cut(s) 171
MslI CAYNNNNRTG 2 cut(s) 383, 449
MspI CCGG 1 cut(s) 158
MspR9I CCNGG 4 cut(s) 159, 288, 312, 420
Mva1269I GAATGC 1 cut(s) 135
MvaI CCWGG 3 cut(s) 288, 312, 420
MwoI GCNNNNNNNGC 2 cut(s) 401, 415
NciI CCSGG 1 cut(s) 159
NdeII GATC 1 cut(s) 64
NlaIII CATG 6 cut(s) 10, 59, 87, 243, 273, 388
NlaIV GGNNCC 6 cut(s) 66, 103, 162, 403, 438, 453
OliI CACNNNNGTG 1 cut(s) 449
PaqCI CACCTGC 1 cut(s) 386
PceI AGGCCT 1 cut(s) 423
PctI GAATGC 1 cut(s) 135
PfeI GAWTC 1 cut(s) 249
PfoI TCCNGGA 1 cut(s) 157
PkrI GCNGC 2 cut(s) 18, 417
PleI GAGTC 1 cut(s) 128
PpsI GAGTC 1 cut(s) 128
PpuMI RGGWCCY 1 cut(s) 161
Psp5II RGGWCCY 1 cut(s) 161
Psp6I CCWGG 3 cut(s) 286, 310, 418
PspFI CCCAGC 1 cut(s) 126
PspGI CCWGG 3 cut(s) 286, 310, 418
PspN4I GGNNCC 6 cut(s) 66, 103, 162, 403, 438, 453
PspPI GGNCC 2 cut(s) 161, 346
PspPPI RGGWCCY 1 cut(s) 161
PsrI GAACNNNNNNTAC 2 cut(s) 311, 343
PsuI RGATCY 1 cut(s) 64
RseI CAYNNNNRTG 2 cut(s) 383, 449
SaqAI TTAA 1 cut(s) 171
SatI GCNGC 2 cut(s) 17, 416
Sau3AI GATC 1 cut(s) 64
Sau96I GGNCC 2 cut(s) 161, 346
SchI GAGTC 1 cut(s) 129
ScrFI CCNGG 4 cut(s) 159, 288, 312, 420
SduI GDGCHC 1 cut(s) 302
SetI ASST 7 cut(s) 75, 98, 166, 219, 362, 400, 482
SinI GGWCC 2 cut(s) 161, 346
SmiMI CAYNNNNRTG 2 cut(s) 383, 449
SmlI CTYRAG 1 cut(s) 431
SmoI CTYRAG 1 cut(s) 431
Sse9I AATT 2 cut(s) 11, 265
SseBI AGGCCT 1 cut(s) 423
SsiI CCGC 1 cut(s) 468
SspMI CTAG 1 cut(s) 116
StuI AGGCCT 1 cut(s) 423
StyD4I CCNGG 4 cut(s) 157, 286, 310, 418
StyI CCWWGG 1 cut(s) 115
TaqI TCGA 1 cut(s) 32
TasI AATT 2 cut(s) 11, 265
TfiI GAWTC 1 cut(s) 249
Tru1I TTAA 1 cut(s) 171
Tru9I TTAA 1 cut(s) 171
TscAI CASTG 2 cut(s) 385, 417
TseI GCWGC 2 cut(s) 16, 415
TspDTI ATGAA 4 cut(s) 23, 44, 237, 258
TspRI CASTG 2 cut(s) 385, 417
VpaK11BI GGWCC 2 cut(s) 161, 346
XapI RAATTY 1 cut(s) 265
XmaJI CCTAGG 1 cut(s) 115
XspI CTAG 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.