Rmu_sc0035578.1_g000001

Myo-inositol oxygenase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0035578.1
Physical Location & Seq
Forward (+)
1 .. 1283
1283 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0035578.1_g000001.1.cds

Sequence Viewer

Length: 570 bp
ggattatgatgttaatagtgagcggagagatggggttggggaattctaccgaatccagcacatcaaccaaagtgttgattttgtgaagcggatgagagaagaatatggaaaattggacaaggtggaaatgagcatatgggaatgctgtgaacttttgaatgaagttgtggatgagagtgatcctgatttggatgagcctcagattgagcatctgctgcagactgctgaagctatcagaaaagactaccctaaagaaggctggctacatttgactgccctaatccatgatcttggaaaggtgcttcatcttcctgcttttggtgagcttcctcagtgggctgtcgtaggagacacatttcctgttgggtgtgcctttgatgagtcaattgttcaccacaagcatttccaggaaaatcctgactacagcaatcctgcttataacaccaaatatggaatttactctgaaggctgtggacttaacaatgtgctgatgtcatggggacacgacgactacatgttcttggtatacatattagccaaacctccctatttctccattgtgcatacact
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

190

Amino Acids

22.02

Weight (kDa)

4.74

Isoelectric Point (pI)

41.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 439
AccBSI CCGCTC 1 cut(s) 23
AccI GTMKAC 1 cut(s) 526
AciI CCGC 2 cut(s) 23, 89
AclWI GGATC 1 cut(s) 174
AcsI RAATTY 2 cut(s) 42, 454
AcuI CTGAAG 2 cut(s) 247, 484
AfiI CCNNNNNNNGG 2 cut(s) 255, 318
AflIII ACRYGT 1 cut(s) 514
AgsI TTSAA 1 cut(s) 158
AjnI CCWGG 1 cut(s) 406
AluBI AGCT 2 cut(s) 231, 326
AluI AGCT 2 cut(s) 231, 326
Alw26I GTCTC 1 cut(s) 343
AlwI GGATC 1 cut(s) 174
ApeKI GCWGC 1 cut(s) 215
ApoI RAATTY 2 cut(s) 42, 454
AsuHPI GGTGA 2 cut(s) 333, 384
BarI GAAGNNNNNNTAC 2 cut(s) 247, 279
BbvI GCAGC 1 cut(s) 202
BccI CCATC 1 cut(s) 24
BciT130I CCWGG 1 cut(s) 408
BcoDI GTCTC 1 cut(s) 343
BfmI CTRYAG 2 cut(s) 216, 422
BisI GCNGC 1 cut(s) 216
BlsI GCNGC 1 cut(s) 217
Bme1390I CCNGG 1 cut(s) 408
BmrFI CCNGG 1 cut(s) 408
BmsI GCATC 1 cut(s) 218
Bsc4I CCNNNNNNNGG 2 cut(s) 255, 318
BseBI CCWGG 1 cut(s) 408
BseGI GGATG 3 cut(s) 97, 176, 197
BseLI CCNNNNNNNGG 2 cut(s) 255, 318
BseMII CTCAG 2 cut(s) 213, 345
BseXI GCAGC 1 cut(s) 202
BslFI GGGAC 1 cut(s) 514
BslI CCNNNNNNNGG 2 cut(s) 255, 318
BsmAI GTCTC 1 cut(s) 343
BsmFI GGGAC 1 cut(s) 514
BsmI GAATGC 1 cut(s) 147
Bsp143I GATC 2 cut(s) 179, 287
BspACI CCGC 2 cut(s) 23, 89
BspCNI CTCAG 2 cut(s) 212, 344
BspMAI CTGCAG 1 cut(s) 220
BspPI GGATC 1 cut(s) 174
BsrBI CCGCTC 1 cut(s) 23
BssMI GATC 2 cut(s) 179, 287
BssNAI GTATAC 1 cut(s) 527
Bst1107I GTATAC 1 cut(s) 527
Bst2UI CCWGG 1 cut(s) 408
BstAPI GCANNNNNTGC 1 cut(s) 215
BstC8I GCNNGC 1 cut(s) 261
BstDEI CTNAG 2 cut(s) 199, 331
BstENI CCTNNNNNAGG 1 cut(s) 253
BstF5I GGATG 3 cut(s) 97, 176, 197
BstKTI GATC 2 cut(s) 182, 290
BstMAI GTCTC 1 cut(s) 343
BstMBI GATC 2 cut(s) 179, 287
BstMWI GCNNNNNNNGC 1 cut(s) 215
BstNI CCWGG 1 cut(s) 408
BstNSI RCATGY 1 cut(s) 518
BstSCI CCNGG 1 cut(s) 406
BstSFI CTRYAG 2 cut(s) 216, 422
BstV1I GCAGC 1 cut(s) 202
BstXI CCANNNNNNTGG 1 cut(s) 291
BstZ17I GTATAC 1 cut(s) 527
BtsCI GGATG 3 cut(s) 97, 176, 197
BtsIMutI CAGTG 1 cut(s) 339
Cac8I GCNNGC 1 cut(s) 261
CviAII CATG 3 cut(s) 285, 496, 515
CviJI RGCY 8 cut(s) 197, 231, 259, 263, 326, 339, 469, 537
CviKI_1 RGCY 8 cut(s) 197, 231, 259, 263, 326, 339, 469, 537
DdeI CTNAG 2 cut(s) 199, 331
DpnI GATC 2 cut(s) 181, 289
DpnII GATC 2 cut(s) 179, 287
Eco57I CTGAAG 2 cut(s) 247, 484
EcoNI CCTNNNNNAGG 1 cut(s) 253
EcoRI GAATTC 1 cut(s) 42
EcoRII CCWGG 1 cut(s) 406
FaeI CATG 3 cut(s) 288, 499, 518
FaqI GGGAC 1 cut(s) 514
FatI CATG 3 cut(s) 284, 495, 514
FauNDI CATATG 1 cut(s) 135
FblI GTMKAC 1 cut(s) 526
Fnu4HI GCNGC 1 cut(s) 216
FokI GGATG 3 cut(s) 104, 183, 204
Fsp4HI GCNGC 1 cut(s) 216
GluI GCNGC 1 cut(s) 216
Hin1II CATG 3 cut(s) 288, 499, 518
HinfI GANTC 2 cut(s) 52, 381
HphI GGTGA 2 cut(s) 333, 384
Hpy166II GTNNAC 4 cut(s) 150, 392, 474, 527
Hpy188I TCNGA 3 cut(s) 202, 237, 464
Hpy188III TCNNGA 2 cut(s) 183, 417
Hpy8I GTNNAC 4 cut(s) 150, 392, 474, 527
Hpy99I CGWCG 1 cut(s) 510
HpyAV CCTTC 2 cut(s) 249, 459
HpyCH4V TGCA 2 cut(s) 218, 563
HpyF10VI GCNNNNNNNGC 1 cut(s) 215
HpyF3I CTNAG 2 cut(s) 199, 331
Hsp92II CATG 3 cut(s) 288, 499, 518
Kzo9I GATC 2 cut(s) 179, 287
LpnPI CCDG 9 cut(s) 69, 196, 245, 325, 373, 393, 420, 430, 445
Lsp1109I GCAGC 1 cut(s) 202
LweI GCATC 1 cut(s) 218
MalI GATC 2 cut(s) 181, 289
MbiI CCGCTC 1 cut(s) 23
MboI GATC 2 cut(s) 179, 287
MboII GAAGA 2 cut(s) 111, 300
MfeI CAATTG 1 cut(s) 385
MluCI AATT 4 cut(s) 42, 111, 385, 454
MlyI GAGTC 1 cut(s) 390
MnlI CCTC 3 cut(s) 208, 340, 553
MseI TTAA 2 cut(s) 13, 478
MspR9I CCNGG 1 cut(s) 408
MunI CAATTG 1 cut(s) 385
Mva1269I GAATGC 1 cut(s) 147
MvaI CCWGG 1 cut(s) 408
MwoI GCNNNNNNNGC 1 cut(s) 215
NdeI CATATG 1 cut(s) 135
NdeII GATC 2 cut(s) 179, 287
NlaIII CATG 3 cut(s) 288, 499, 518
NspI RCATGY 1 cut(s) 518
PciI ACATGT 1 cut(s) 514
PctI GAATGC 1 cut(s) 147
PfeI GAWTC 1 cut(s) 52
PfoI TCCNGGA 1 cut(s) 406
PkrI GCNGC 1 cut(s) 217
PleI GAGTC 1 cut(s) 389
PpsI GAGTC 1 cut(s) 389
PscI ACATGT 1 cut(s) 514
PsiI TTATAA 1 cut(s) 439
Psp6I CCWGG 1 cut(s) 406
PspGI CCWGG 1 cut(s) 406
PstI CTGCAG 1 cut(s) 220
SaqAI TTAA 2 cut(s) 13, 478
SatI GCNGC 1 cut(s) 216
Sau3AI GATC 2 cut(s) 179, 287
SchI GAGTC 1 cut(s) 390
ScrFI CCNGG 1 cut(s) 408
SetI ASST 5 cut(s) 124, 233, 301, 328, 545
SfaNI GCATC 1 cut(s) 218
SfcI CTRYAG 2 cut(s) 216, 422
Sse9I AATT 4 cut(s) 42, 111, 385, 454
SsiI CCGC 2 cut(s) 23, 89
StyD4I CCNGG 1 cut(s) 406
TasI AATT 4 cut(s) 42, 111, 385, 454
TfiI GAWTC 1 cut(s) 52
Tru1I TTAA 2 cut(s) 13, 478
Tru9I TTAA 2 cut(s) 13, 478
TscAI CASTG 1 cut(s) 339
TseI GCWGC 1 cut(s) 215
TspDTI ATGAA 2 cut(s) 175, 294
TspRI CASTG 1 cut(s) 339
XagI CCTNNNNNAGG 1 cut(s) 253
XapI RAATTY 2 cut(s) 42, 454
XceI RCATGY 1 cut(s) 518
XmiI GTMKAC 1 cut(s) 526
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.