Rmu_ssc0000041.1_g000002

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000041.1
OG0003946
Physical Location & Seq
Forward (+)
6324 .. 7223
900 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000041.1_g000002.1.cds

Sequence Viewer

Length: 852 bp
atgtctttacatcaccctgaactaaagtggttgctttgtgagaagtggttgaaaacacaccatggctataaggctccttgtgaatcaataattttcaactctcaatggggatcaatctcgttgtttgttgatcttccagtcatagacgatgtatattatggtattggcatatataaatacagagatgagttggaggaattgggtgtcatcacggattttgaaggaggagtggtgattgtagcaaaaggtctttccagtcccatcgaagatgaactaattactgcagattgtattttatcattgctagaatgcctcaagtgtctgatgacaaagtctcctgatgaatcttcactgagtaactttctcaagaacattgcaaaaagcaagtgtttgaagacccagaatggtattctgaagccatcagatgcaccaaccattggtgaaaacttttacagaactgacatttctgtatacaagaatcagttaagagatattagcgtgaaggtagattctttggatgtttgttctcttctttctgggattcttttttcgctgactgaagcaacttcaataacaaggatttatagcttcctcaacaagttccaatggaatccagaagttctagataaccttaagtctcaggtgtggatacctaccccaaagggtactggcaagtggattaattctcaggattgtgtacttcatgatagcaagcatgtgtttggatcctgcttgttttctcttgacgagttttacaagaaagaatttctccccttttctcttcggcctttagagttgctgaaaaccctacaaccaatgattacttggagctatggaacagctgggctatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

283

Amino Acids

32.03

Weight (kDa)

5.57

Isoelectric Point (pI)

33.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 437
AccI GTMKAC 1 cut(s) 471
AclWI GGATC 3 cut(s) 118, 720, 733
AcsI RAATTY 1 cut(s) 764
AcuI CTGAAG 2 cut(s) 434, 579
AfaI GTAC 2 cut(s) 667, 699
AfiI CCNNNNNNNGG 1 cut(s) 437
AflII CTTAAG 1 cut(s) 632
AgsI TTSAA 5 cut(s) 52, 97, 221, 394, 570
AluBI AGCT 3 cut(s) 588, 831, 842
AluI AGCT 3 cut(s) 588, 831, 842
Alw26I GTCTC 2 cut(s) 339, 642
AlwI GGATC 3 cut(s) 118, 720, 733
AoxI GGCC 1 cut(s) 785
ApoI RAATTY 1 cut(s) 764
AseI ATTAAT 1 cut(s) 681
AsuHPI GGTGA 3 cut(s) 5, 244, 452
BamHI GGATCC 1 cut(s) 725
BbsI GAAGAC 1 cut(s) 401
BccI CCATC 2 cut(s) 269, 427
BciVI GTATCC 1 cut(s) 642
BcoDI GTCTC 2 cut(s) 339, 642
BfaI CTAG 2 cut(s) 305, 623
BfmI CTRYAG 1 cut(s) 282
BfrI CTTAAG 1 cut(s) 632
BfuI GTATCC 1 cut(s) 642
BmiI GGNNCC 2 cut(s) 75, 727
BmsI GCATC 1 cut(s) 415
BpiI GAAGAC 1 cut(s) 401
BpuEI CTTGAG 2 cut(s) 299, 350
BsaJI CCNNGG 1 cut(s) 61
BsaXI ACNNNNNCTCC 4 cut(s) 216, 246, 319, 349
Bsc4I CCNNNNNNNGG 1 cut(s) 437
Bse1I ACTGG 3 cut(s) 137, 255, 673
Bse3DI GCAATG 2 cut(s) 299, 372
BseDI CCNNGG 1 cut(s) 61
BseGI GGATG 1 cut(s) 523
BseLI CCNNNNNNNGG 1 cut(s) 437
BseMI GCAATG 2 cut(s) 299, 372
BseMII CTCAG 3 cut(s) 344, 653, 701
BseNI ACTGG 3 cut(s) 137, 255, 673
BseRI GAGGAG 1 cut(s) 240
BseYI CCCAGC 1 cut(s) 842
BshFI GGCC 1 cut(s) 787
BslFI GGGAC 1 cut(s) 243
BslI CCNNNNNNNGG 1 cut(s) 437
BsmAI GTCTC 2 cut(s) 339, 642
BsmFI GGGAC 1 cut(s) 243
BsmI GAATGC 1 cut(s) 314
BsnI GGCC 1 cut(s) 787
Bsp143I GATC 3 cut(s) 110, 130, 725
Bsp19I CCATGG 1 cut(s) 61
BspANI GGCC 1 cut(s) 787
BspCNI CTCAG 3 cut(s) 345, 652, 700
BspHI TCATGA 1 cut(s) 703
BspLI GGNNCC 2 cut(s) 75, 727
BspMAI CTGCAG 1 cut(s) 286
BspPI GGATC 3 cut(s) 118, 720, 733
BspTI CTTAAG 1 cut(s) 632
BsrDI GCAATG 2 cut(s) 299, 372
BsrI ACTGG 3 cut(s) 137, 255, 673
BssECI CCNNGG 1 cut(s) 61
BssMI GATC 3 cut(s) 110, 130, 725
BssNAI GTATAC 1 cut(s) 472
BssT1I CCWWGG 1 cut(s) 61
Bst1107I GTATAC 1 cut(s) 472
Bst6I CTCTTC 2 cut(s) 534, 786
BstAFI CTTAAG 1 cut(s) 632
BstC8I GCNNGC 1 cut(s) 713
BstDEI CTNAG 3 cut(s) 353, 639, 687
BstDSI CCRYGG 1 cut(s) 61
BstF5I GGATG 1 cut(s) 523
BstKTI GATC 3 cut(s) 113, 133, 728
BstMAI GTCTC 2 cut(s) 339, 642
BstMBI GATC 3 cut(s) 110, 130, 725
BstNSI RCATGY 1 cut(s) 719
BstSFI CTRYAG 1 cut(s) 282
BstV2I GAAGAC 1 cut(s) 401
BstX2I RGATCY 1 cut(s) 725
BstYI RGATCY 1 cut(s) 725
BstZ17I GTATAC 1 cut(s) 472
BsuI GTATCC 1 cut(s) 642
BsuRI GGCC 1 cut(s) 787
BtgI CCRYGG 1 cut(s) 61
BtsCI GGATG 1 cut(s) 523
BtsIMutI CAGTG 1 cut(s) 350
Cac8I GCNNGC 1 cut(s) 713
CciI TCATGA 1 cut(s) 703
Csp6I GTAC 2 cut(s) 666, 698
CviAII CATG 3 cut(s) 62, 704, 716
CviJI RGCY 8 cut(s) 66, 74, 418, 588, 787, 831, 842, 847
CviKI_1 RGCY 8 cut(s) 66, 74, 418, 588, 787, 831, 842, 847
CviQI GTAC 2 cut(s) 666, 698
DdeI CTNAG 3 cut(s) 353, 639, 687
DpnI GATC 3 cut(s) 112, 132, 727
DpnII GATC 3 cut(s) 110, 130, 725
Eam1104I CTCTTC 2 cut(s) 534, 786
EarI CTCTTC 2 cut(s) 534, 786
Eco130I CCWWGG 1 cut(s) 61
Eco57I CTGAAG 2 cut(s) 434, 579
EcoT14I CCWWGG 1 cut(s) 61
ErhI CCWWGG 1 cut(s) 61
FaeI CATG 3 cut(s) 65, 707, 719
FaqI GGGAC 1 cut(s) 243
FatI CATG 3 cut(s) 61, 703, 715
FblI GTMKAC 1 cut(s) 471
FokI GGATG 1 cut(s) 530
FspBI CTAG 2 cut(s) 305, 623
GsaI CCCAGC 1 cut(s) 846
HaeIII GGCC 1 cut(s) 787
Hin1II CATG 3 cut(s) 65, 707, 719
HinfI GANTC 6 cut(s) 83, 344, 478, 509, 541, 610
HphI GGTGA 3 cut(s) 5, 244, 452
Hpy166II GTNNAC 2 cut(s) 472, 698
Hpy188I TCNGA 3 cut(s) 324, 414, 424
Hpy188III TCNNGA 7 cut(s) 338, 367, 614, 623, 689, 704, 743
Hpy8I GTNNAC 2 cut(s) 472, 698
HpyAV CCTTC 2 cut(s) 215, 496
HpyCH4V TGCA 3 cut(s) 284, 377, 428
HpyF3I CTNAG 3 cut(s) 353, 639, 687
Hsp92II CATG 3 cut(s) 65, 707, 719
Kzo9I GATC 3 cut(s) 110, 130, 725
LmnI GCTCC 2 cut(s) 79, 828
LweI GCATC 1 cut(s) 415
MaeI CTAG 2 cut(s) 305, 623
MaeIII GTNAC 1 cut(s) 356
MalI GATC 3 cut(s) 112, 132, 727
MboI GATC 3 cut(s) 110, 130, 725
MboII GAAGA 6 cut(s) 125, 278, 339, 406, 521, 773
MflI RGATCY 1 cut(s) 725
MluCI AATT 5 cut(s) 90, 197, 276, 682, 764
MmeI TCCRAC 1 cut(s) 171
MnlI CCTC 4 cut(s) 187, 218, 323, 602
MseI TTAA 3 cut(s) 485, 633, 681
MspA1I CMGCKG 1 cut(s) 842
MspCI CTTAAG 1 cut(s) 632
Mva1269I GAATGC 1 cut(s) 314
NcoI CCATGG 1 cut(s) 61
NdeII GATC 3 cut(s) 110, 130, 725
NlaIII CATG 3 cut(s) 65, 707, 719
NlaIV GGNNCC 2 cut(s) 75, 727
NspI RCATGY 1 cut(s) 719
PagI TCATGA 1 cut(s) 703
PctI GAATGC 1 cut(s) 314
PfeI GAWTC 6 cut(s) 83, 344, 478, 509, 541, 610
PflFI GACNNNGTC 1 cut(s) 331
PflMI CCANNNNNTGG 1 cut(s) 437
PshBI ATTAAT 1 cut(s) 681
PspFI CCCAGC 1 cut(s) 842
PspN4I GGNNCC 2 cut(s) 75, 727
PstI CTGCAG 1 cut(s) 286
PsuI RGATCY 1 cut(s) 725
PsyI GACNNNGTC 1 cut(s) 331
PvuII CAGCTG 1 cut(s) 842
RsaI GTAC 2 cut(s) 667, 699
RsaNI GTAC 2 cut(s) 666, 698
SaqAI TTAA 3 cut(s) 485, 633, 681
Sau3AI GATC 3 cut(s) 110, 130, 725
SetI ASST 8 cut(s) 250, 507, 590, 633, 645, 655, 833, 844
SfaNI GCATC 1 cut(s) 415
SfcI CTRYAG 1 cut(s) 282
SmlI CTYRAG 3 cut(s) 314, 365, 632
SmoI CTYRAG 3 cut(s) 314, 365, 632
Sse9I AATT 5 cut(s) 90, 197, 276, 682, 764
SspMI CTAG 2 cut(s) 305, 623
StyI CCWWGG 1 cut(s) 61
TaqI TCGA 1 cut(s) 264
TasI AATT 5 cut(s) 90, 197, 276, 682, 764
TatI WGTACW 1 cut(s) 697
TfiI GAWTC 6 cut(s) 83, 344, 478, 509, 541, 610
Tru1I TTAA 3 cut(s) 485, 633, 681
Tru9I TTAA 3 cut(s) 485, 633, 681
TscAI CASTG 1 cut(s) 357
TspDTI ATGAA 3 cut(s) 285, 357, 692
TspGWI ACGGA 1 cut(s) 227
TspRI CASTG 1 cut(s) 357
Tth111I GACNNNGTC 1 cut(s) 331
Van91I CCANNNNNTGG 1 cut(s) 437
Vha464I CTTAAG 1 cut(s) 632
VspI ATTAAT 1 cut(s) 681
XapI RAATTY 1 cut(s) 764
XbaI TCTAGA 1 cut(s) 622
XceI RCATGY 1 cut(s) 719
XcmI CCANNNNNNNNNTGG 1 cut(s) 822
XmiI GTMKAC 1 cut(s) 471
XspI CTAG 2 cut(s) 305, 623
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.