Rroxscaffold_2G00125080

Belongs to the peptidase A1 family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
59689326 .. 59690987
1662 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00125080.1

Sequence Viewer

Length: 207 bp
ATGAGAGAGATAGAGGTGAATAGAAGAGGAAGAAAAACTAAAAAGCATCTAAAATGGTATAACATGGTGCAACAAGGTCGTATGAGCCAGCCGATTTTCTCTATTTGGCTCAATCATGATCCAAAATCACCAGTGGGAGGTGAAATCGTCTTTGGAGGATATGATTGGAGACACCTTGTGAAAATTCAAACTATTGCAATGATTTGA

Protein Analysis

68

Amino Acids

8.11

Weight (kDa)

10.43

Isoelectric Point (pI)

56.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Asp PF00026 15 - 59 4.1e-08 Eukaryotic aspartyl protease
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 113
AcsI RAATTY 1 cut(s) 183
AdeI CACNNNGTG 1 cut(s) 178
AfiI CCNNNNNNNGG 1 cut(s) 137
AgsI TTSAA 1 cut(s) 188
AjuI GAANNNNNNNTTGG 2 cut(s) 135, 167
Alw26I GTCTC 1 cut(s) 163
AlwI GGATC 1 cut(s) 113
ApoI RAATTY 1 cut(s) 183
AsuHPI GGTGA 3 cut(s) 28, 120, 152
BcgI CGANNNNNNTGC 2 cut(s) 59, 93
BcoDI GTCTC 1 cut(s) 163
BmsI GCATC 1 cut(s) 55
Bsc4I CCNNNNNNNGG 1 cut(s) 137
Bse1I ACTGG 1 cut(s) 131
Bse3DI GCAATG 1 cut(s) 204
BseLI CCNNNNNNNGG 1 cut(s) 137
BseMI GCAATG 1 cut(s) 204
BseNI ACTGG 1 cut(s) 131
BslI CCNNNNNNNGG 1 cut(s) 137
BsmAI GTCTC 1 cut(s) 163
Bsp143I GATC 1 cut(s) 118
BspHI TCATGA 1 cut(s) 115
BspPI GGATC 1 cut(s) 113
BsrDI GCAATG 1 cut(s) 204
BsrI ACTGG 1 cut(s) 131
BssMI GATC 1 cut(s) 118
Bst6I CTCTTC 1 cut(s) 19
BstC8I GCNNGC 1 cut(s) 89
BstKTI GATC 1 cut(s) 121
BstMAI GTCTC 1 cut(s) 163
BstMBI GATC 1 cut(s) 118
BtsIMutI CAGTG 1 cut(s) 138
Cac8I GCNNGC 1 cut(s) 89
CciI TCATGA 1 cut(s) 115
CviAII CATG 2 cut(s) 64, 116
CviJI RGCY 3 cut(s) 87, 91, 109
CviKI_1 RGCY 3 cut(s) 87, 91, 109
DpnI GATC 1 cut(s) 120
DpnII GATC 1 cut(s) 118
DraIII CACNNNGTG 1 cut(s) 178
Eam1104I CTCTTC 1 cut(s) 19
EarI CTCTTC 1 cut(s) 19
FaeI CATG 2 cut(s) 67, 119
FaiI YATR 5 cut(s) 60, 65, 83, 117, 162
FatI CATG 2 cut(s) 63, 115
Hin1II CATG 2 cut(s) 67, 119
HphI GGTGA 3 cut(s) 28, 120, 152
Hpy188III TCNNGA 1 cut(s) 116
HpyCH4V TGCA 2 cut(s) 70, 197
Hsp92II CATG 2 cut(s) 67, 119
Kzo9I GATC 1 cut(s) 118
LpnPI CCDG 2 cut(s) 101, 144
LweI GCATC 1 cut(s) 55
MalI GATC 1 cut(s) 120
MboI GATC 1 cut(s) 118
MboII GAAGA 2 cut(s) 36, 42
MluCI AATT 1 cut(s) 183
MnlI CCTC 4 cut(s) 7, 20, 131, 149
NdeII GATC 1 cut(s) 118
NlaIII CATG 2 cut(s) 67, 119
PagI TCATGA 1 cut(s) 115
Sau3AI GATC 1 cut(s) 118
SetI ASST 4 cut(s) 18, 79, 142, 177
SfaNI GCATC 1 cut(s) 55
SgeI CNNG 6 cut(s) 76, 86, 100, 128, 143, 188
Sse9I AATT 1 cut(s) 183
TasI AATT 1 cut(s) 183
TscAI CASTG 1 cut(s) 138
TspRI CASTG 1 cut(s) 138
XapI RAATTY 1 cut(s) 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.