Rroxscaffold_4G00291470

receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
11898516 .. 11901364
2849 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00291470.1

Sequence Viewer

Length: 297 bp
ATGAAATCCACAGTGACACTTGAGTTCACCAAATGCAAGGTGATCACATTATACCCCGTGATCGTCGAGGGTACAACAATTAACGTGACATTGGCCTCGGCTAGTAACTCCACCCTACCTCCGATCATCGGCAATGGAAGTGTTCACAAGATCACTATTGGATGGTTGAACATCGATTGCGGGAACAGTGATGTACGTACAGATCCCACAAACCTACTGACATGGGTCACAGACAAGGACTTGATCCAAACGGGCATCAACAAAGAAGTTCCACAAAAGCAATCACTTGAGTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

98

Amino Acids

10.63

Weight (kDa)

5.65

Isoelectric Point (pI)

25.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 180
AclWI GGATC 2 cut(s) 197, 238
AfaI GTAC 3 cut(s) 73, 195, 199
AfiI CCNNNNNNNGG 1 cut(s) 128
AgsI TTSAA 1 cut(s) 169
AlwI GGATC 2 cut(s) 197, 238
AoxI GGCC 1 cut(s) 93
AsuHPI GGTGA 2 cut(s) 19, 52
BccI CCATC 1 cut(s) 156
BclI TGATCA 1 cut(s) 42
BfaI CTAG 1 cut(s) 102
BmsI GCATC 1 cut(s) 264
BoxI GACNNNNGTC 1 cut(s) 224
BpuEI CTTGAG 1 cut(s) 41
Bsa29I ATCGAT 1 cut(s) 174
BsaAI YACGTR 1 cut(s) 197
BsaJI CCNNGG 1 cut(s) 96
BsaXI ACNNNNNCTCC 2 cut(s) 103, 133
Bsc4I CCNNNNNNNGG 1 cut(s) 128
Bse3DI GCAATG 1 cut(s) 139
BseCI ATCGAT 1 cut(s) 174
BseDI CCNNGG 1 cut(s) 96
BseGI GGATG 1 cut(s) 167
BseLI CCNNNNNNNGG 1 cut(s) 128
BseMI GCAATG 1 cut(s) 139
BshFI GGCC 1 cut(s) 95
BshVI ATCGAT 1 cut(s) 174
BslI CCNNNNNNNGG 1 cut(s) 128
BsnI GGCC 1 cut(s) 95
Bsp143I GATC 6 cut(s) 42, 60, 123, 150, 202, 243
BspACI CCGC 1 cut(s) 180
BspANI GGCC 1 cut(s) 95
BspDI ATCGAT 1 cut(s) 174
BspPI GGATC 2 cut(s) 197, 238
BsrDI GCAATG 1 cut(s) 139
BssECI CCNNGG 1 cut(s) 96
BssMI GATC 6 cut(s) 42, 60, 123, 150, 202, 243
Bst4CI ACNGT 2 cut(s) 13, 188
BstBAI YACGTR 1 cut(s) 197
BstF5I GGATG 1 cut(s) 167
BstKTI GATC 6 cut(s) 45, 63, 126, 153, 205, 246
BstMBI GATC 6 cut(s) 42, 60, 123, 150, 202, 243
BstPAI GACNNNNGTC 1 cut(s) 224
BstSNI TACGTA 1 cut(s) 197
BstX2I RGATCY 1 cut(s) 202
BstYI RGATCY 1 cut(s) 202
Bsu15I ATCGAT 1 cut(s) 174
BsuRI GGCC 1 cut(s) 95
BsuTUI ATCGAT 1 cut(s) 174
BtsCI GGATG 1 cut(s) 167
BtsIMutI CAGTG 2 cut(s) 18, 193
ClaI ATCGAT 1 cut(s) 174
Csp6I GTAC 3 cut(s) 72, 194, 198
CviAII CATG 1 cut(s) 222
CviJI RGCY 2 cut(s) 95, 101
CviKI_1 RGCY 2 cut(s) 95, 101
CviQI GTAC 3 cut(s) 72, 194, 198
DpnI GATC 6 cut(s) 44, 62, 125, 152, 204, 245
DpnII GATC 6 cut(s) 42, 60, 123, 150, 202, 243
Eco105I TACGTA 1 cut(s) 197
FaeI CATG 1 cut(s) 225
FaiI YATR 2 cut(s) 52, 223
FatI CATG 1 cut(s) 221
FauI CCCGC 1 cut(s) 173
FbaI TGATCA 1 cut(s) 42
FokI GGATG 1 cut(s) 174
FspBI CTAG 1 cut(s) 102
HaeIII GGCC 1 cut(s) 95
Hin1II CATG 1 cut(s) 225
HinfI GANTC 1 cut(s) 290
HphI GGTGA 2 cut(s) 19, 52
Hpy166II GTNNAC 2 cut(s) 27, 145
Hpy188I TCNGA 1 cut(s) 123
Hpy188III TCNNGA 1 cut(s) 294
Hpy8I GTNNAC 2 cut(s) 27, 145
Hpy99I CGWCG 1 cut(s) 68
HpyCH4III ACNGT 2 cut(s) 13, 188
HpyCH4IV ACGT 2 cut(s) 84, 196
HpyCH4V TGCA 1 cut(s) 36
HpySE526I ACGT 2 cut(s) 84, 196
Hsp92II CATG 1 cut(s) 225
Ksp22I TGATCA 1 cut(s) 42
Kzo9I GATC 6 cut(s) 42, 60, 123, 150, 202, 243
LweI GCATC 1 cut(s) 264
MaeI CTAG 1 cut(s) 102
MaeII ACGT 2 cut(s) 84, 196
MaeIII GTNAC 4 cut(s) 13, 85, 104, 226
MalI GATC 6 cut(s) 44, 62, 125, 152, 204, 245
MboI GATC 6 cut(s) 42, 60, 123, 150, 202, 243
MflI RGATCY 1 cut(s) 202
MluCI AATT 1 cut(s) 78
MnlI CCTC 3 cut(s) 61, 106, 129
MseI TTAA 1 cut(s) 81
NdeII GATC 6 cut(s) 42, 60, 123, 150, 202, 243
NlaIII CATG 1 cut(s) 225
NmeAIII GCCGAG 1 cut(s) 77
NmuCI GTSAC 3 cut(s) 13, 85, 226
Ppu21I YACGTR 1 cut(s) 197
PshAI GACNNNNGTC 1 cut(s) 224
PsuI RGATCY 1 cut(s) 202
RsaI GTAC 3 cut(s) 73, 195, 199
RsaNI GTAC 3 cut(s) 72, 194, 198
SaqAI TTAA 1 cut(s) 81
Sau3AI GATC 6 cut(s) 42, 60, 123, 150, 202, 243
SetI ASST 5 cut(s) 42, 87, 121, 199, 216
SfaNI GCATC 1 cut(s) 264
SmlI CTYRAG 2 cut(s) 20, 287
SmoI CTYRAG 2 cut(s) 20, 287
SnaBI TACGTA 1 cut(s) 197
Sse9I AATT 1 cut(s) 78
SsiI CCGC 1 cut(s) 180
SspMI CTAG 1 cut(s) 102
TaaI ACNGT 2 cut(s) 13, 188
TaiI ACGT 2 cut(s) 87, 199
TaqI TCGA 2 cut(s) 66, 174
TasI AATT 1 cut(s) 78
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TscAI CASTG 2 cut(s) 18, 193
TseFI GTSAC 3 cut(s) 13, 85, 226
Tsp45I GTSAC 3 cut(s) 13, 85, 226
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 2 cut(s) 18, 193
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.