Rroxscaffold_4G00291480

Carbohydrate-binding protein of the ER

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
11904383 .. 11905681
1299 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00291480.1

Sequence Viewer

Length: 294 bp
ATGAAATTCACAGTGACACTTGAGTTCACCAAATGCAAGGTGATCACATTATACCCTGTGATCGTCGAGGGTACAACAATTAACGTGACATTGGCCTCGGCTAGTAGCTCCACCCTACCTCCGATCATCAGTGCAATGGAAGTGTTCACAAGAGTGGATCATGAAAAGAGTTCATCTCCTTCTCCTCCTTCTCCAGCCTCACATGGAACTAGAGGAACTTCTTTTGTGCGCACATTAGTGTTGAATCAGCAAGATAGAGAAGGAAACAAATCCAACGTGGCAGGTGAGTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

10.38

Weight (kDa)

7.93

Isoelectric Point (pI)

42.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 272
Acc16I TGCGCA 1 cut(s) 230
Acc36I ACCTGC 1 cut(s) 272
AclWI GGATC 1 cut(s) 165
AcsI RAATTY 1 cut(s) 5
AfaI GTAC 1 cut(s) 73
AgsI TTSAA 1 cut(s) 244
AleI CACNNNNGTG 2 cut(s) 152, 236
AluBI AGCT 1 cut(s) 108
AluI AGCT 1 cut(s) 108
AlwI GGATC 1 cut(s) 165
AoxI GGCC 1 cut(s) 93
ApoI RAATTY 1 cut(s) 5
AspLEI GCGC 1 cut(s) 231
AsuHPI GGTGA 2 cut(s) 19, 52
BclI TGATCA 1 cut(s) 42
BfaI CTAG 2 cut(s) 102, 210
BfuAI ACCTGC 1 cut(s) 272
BplI GAGNNNNNCTC 2 cut(s) 160, 192
BpmI CTGGAG 1 cut(s) 177
BpuEI CTTGAG 1 cut(s) 41
BsaJI CCNNGG 1 cut(s) 96
BsaXI ACNNNNNCTCC 2 cut(s) 103, 133
Bse3DI GCAATG 1 cut(s) 141
BseDI CCNNGG 1 cut(s) 96
BseMI GCAATG 1 cut(s) 141
BseRI GAGGAG 1 cut(s) 174
BshFI GGCC 1 cut(s) 95
BsnI GGCC 1 cut(s) 95
Bsp143I GATC 4 cut(s) 42, 60, 123, 157
BspANI GGCC 1 cut(s) 95
BspHI TCATGA 1 cut(s) 160
BspMI ACCTGC 1 cut(s) 272
BspPI GGATC 1 cut(s) 165
BsrDI GCAATG 1 cut(s) 141
BssECI CCNNGG 1 cut(s) 96
BssMI GATC 4 cut(s) 42, 60, 123, 157
Bst4CI ACNGT 1 cut(s) 13
BstHHI GCGC 1 cut(s) 231
BstKTI GATC 4 cut(s) 45, 63, 126, 160
BstMBI GATC 4 cut(s) 42, 60, 123, 157
BsuRI GGCC 1 cut(s) 95
BtsIMutI CAGTG 2 cut(s) 18, 136
BveI ACCTGC 1 cut(s) 272
CciI TCATGA 1 cut(s) 160
CfoI GCGC 1 cut(s) 231
Csp6I GTAC 1 cut(s) 72
CviAII CATG 2 cut(s) 161, 203
CviJI RGCY 4 cut(s) 95, 101, 108, 197
CviKI_1 RGCY 4 cut(s) 95, 101, 108, 197
CviQI GTAC 1 cut(s) 72
DpnI GATC 4 cut(s) 44, 62, 125, 159
DpnII GATC 4 cut(s) 42, 60, 123, 157
FaeI CATG 2 cut(s) 164, 206
FaiI YATR 4 cut(s) 52, 162, 204, 292
FatI CATG 2 cut(s) 160, 202
FbaI TGATCA 1 cut(s) 42
FspAI RTGCGCAY 1 cut(s) 230
FspBI CTAG 2 cut(s) 102, 210
FspI TGCGCA 1 cut(s) 230
GlaI GCGC 1 cut(s) 230
GsuI CTGGAG 1 cut(s) 177
HaeIII GGCC 1 cut(s) 95
HhaI GCGC 1 cut(s) 231
Hin1II CATG 2 cut(s) 164, 206
Hin6I GCGC 1 cut(s) 229
HinP1I GCGC 1 cut(s) 229
HinfI GANTC 2 cut(s) 244, 287
HphI GGTGA 2 cut(s) 19, 52
Hpy166II GTNNAC 2 cut(s) 27, 147
Hpy188I TCNGA 1 cut(s) 123
Hpy188III TCNNGA 1 cut(s) 161
Hpy8I GTNNAC 2 cut(s) 27, 147
Hpy99I CGWCG 1 cut(s) 68
HpyAV CCTTC 3 cut(s) 189, 198, 254
HpyCH4III ACNGT 1 cut(s) 13
HpyCH4IV ACGT 2 cut(s) 84, 276
HpyCH4V TGCA 2 cut(s) 36, 134
HpySE526I ACGT 2 cut(s) 84, 276
Hsp92II CATG 2 cut(s) 164, 206
HspAI GCGC 1 cut(s) 229
Ksp22I TGATCA 1 cut(s) 42
Kzo9I GATC 4 cut(s) 42, 60, 123, 157
LmnI GCTCC 1 cut(s) 113
LpnPI CCDG 3 cut(s) 69, 207, 267
MaeI CTAG 2 cut(s) 102, 210
MaeII ACGT 2 cut(s) 84, 276
MaeIII GTNAC 2 cut(s) 13, 85
MalI GATC 4 cut(s) 44, 62, 125, 159
MboI GATC 4 cut(s) 42, 60, 123, 157
MluCI AATT 2 cut(s) 5, 78
MnlI CCTC 6 cut(s) 61, 106, 129, 195, 206, 208
MseI TTAA 1 cut(s) 81
MslI CAYNNNNRTG 2 cut(s) 152, 236
NdeII GATC 4 cut(s) 42, 60, 123, 157
NlaIII CATG 2 cut(s) 164, 206
NmeAIII GCCGAG 1 cut(s) 77
NmuCI GTSAC 2 cut(s) 13, 85
NsbI TGCGCA 1 cut(s) 230
OliI CACNNNNGTG 2 cut(s) 152, 236
PagI TCATGA 1 cut(s) 160
PaqCI CACCTGC 1 cut(s) 272
PfeI GAWTC 1 cut(s) 244
RsaI GTAC 1 cut(s) 73
RsaNI GTAC 1 cut(s) 72
RseI CAYNNNNRTG 2 cut(s) 152, 236
SaqAI TTAA 1 cut(s) 81
Sau3AI GATC 4 cut(s) 42, 60, 123, 157
SetI ASST 6 cut(s) 42, 87, 110, 121, 279, 286
SmiMI CAYNNNNRTG 2 cut(s) 152, 236
SmlI CTYRAG 1 cut(s) 20
SmoI CTYRAG 1 cut(s) 20
Sse9I AATT 2 cut(s) 5, 78
SspMI CTAG 2 cut(s) 102, 210
TaaI ACNGT 1 cut(s) 13
TaiI ACGT 2 cut(s) 87, 279
TaqI TCGA 1 cut(s) 66
TasI AATT 2 cut(s) 5, 78
TfiI GAWTC 1 cut(s) 244
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TscAI CASTG 2 cut(s) 18, 136
TseFI GTSAC 2 cut(s) 13, 85
Tsp45I GTSAC 2 cut(s) 13, 85
TspDTI ATGAA 3 cut(s) 17, 162, 177
TspRI CASTG 2 cut(s) 18, 136
XapI RAATTY 1 cut(s) 5
XspI CTAG 2 cut(s) 102, 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.