Rroxscaffold_7G00180210

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0001397
Physical Location & Seq
Forward (+)
19709605 .. 19709766
162 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00180210.1

Sequence Viewer

Length: 162 bp
ATGGAAAAGGCTGATGTGAAGGAAAACCAAGATGAGGATAAAGTACAAGATGCGAGATACCAAGGCGAAGTAGCTCCCTCCGAAGAAGCTAAAGTTGATGTAGGAATCATGTCTATATTTTTTTTTCCCGGAGTTCTTAGCAACTTGATACTTGATGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

5.95

Weight (kDa)

4.17

Isoelectric Point (pI)

36.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 45
AfiI CCNNNNNNNGG 1 cut(s) 34
AluBI AGCT 2 cut(s) 74, 89
AluI AGCT 2 cut(s) 74, 89
AsuC2I CCSGG 1 cut(s) 129
BcnI CCSGG 1 cut(s) 129
Bme1390I CCNGG 1 cut(s) 129
BmrFI CCNGG 1 cut(s) 129
BmsI GCATC 1 cut(s) 40
BpuMI CCSGG 1 cut(s) 129
BsaJI CCNNGG 1 cut(s) 61
Bsc4I CCNNNNNNNGG 1 cut(s) 34
BseDI CCNNGG 1 cut(s) 61
BseLI CCNNNNNNNGG 1 cut(s) 34
BsiSI CCGG 1 cut(s) 129
BslI CCNNNNNNNGG 1 cut(s) 34
BssECI CCNNGG 1 cut(s) 61
BssT1I CCWWGG 1 cut(s) 61
BstDEI CTNAG 1 cut(s) 137
BstSCI CCNGG 1 cut(s) 127
Csp6I GTAC 1 cut(s) 44
CviAII CATG 1 cut(s) 109
CviJI RGCY 3 cut(s) 11, 74, 89
CviKI_1 RGCY 3 cut(s) 11, 74, 89
CviQI GTAC 1 cut(s) 44
DdeI CTNAG 1 cut(s) 137
Eco130I CCWWGG 1 cut(s) 61
EcoT14I CCWWGG 1 cut(s) 61
ErhI CCWWGG 1 cut(s) 61
FaeI CATG 1 cut(s) 112
FaiI YATR 2 cut(s) 110, 116
FatI CATG 1 cut(s) 108
HapII CCGG 1 cut(s) 129
Hin1II CATG 1 cut(s) 112
HinfI GANTC 1 cut(s) 105
HpaII CCGG 1 cut(s) 129
Hpy188I TCNGA 1 cut(s) 82
HpyAV CCTTC 1 cut(s) 13
HpyF3I CTNAG 1 cut(s) 137
Hsp92II CATG 1 cut(s) 112
LmnI GCTCC 1 cut(s) 79
LpnPI CCDG 1 cut(s) 142
LweI GCATC 1 cut(s) 40
MboII GAAGA 1 cut(s) 95
MnlI CCTC 2 cut(s) 28, 88
MspI CCGG 1 cut(s) 129
MspR9I CCNGG 1 cut(s) 129
NciI CCSGG 1 cut(s) 129
NlaIII CATG 1 cut(s) 112
PfeI GAWTC 1 cut(s) 105
PfoI TCCNGGA 1 cut(s) 127
RsaI GTAC 1 cut(s) 45
RsaNI GTAC 1 cut(s) 44
ScrFI CCNGG 1 cut(s) 129
SetI ASST 2 cut(s) 76, 91
SfaNI GCATC 1 cut(s) 40
SgeI CNNG 8 cut(s) 41, 59, 66, 74, 121, 140, 141, 157
StyD4I CCNGG 1 cut(s) 127
StyI CCWWGG 1 cut(s) 61
TatI WGTACW 1 cut(s) 43
TfiI GAWTC 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.