Rorug02G0225700

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
22144705 .. 22145001
297 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0225700.1

Sequence Viewer

Length: 297 bp
ATGAGGGCTTTGCGCAATTTGATCGCTCAAAATCAACCTCAAATAGACTTCTTATGTGAGACAAAGAACAGTCAGATTGGGGATTTTAAGGCCCTGCATTGTGAATTAGGGTTTGTGCACTATAAAGAGGTCCTGAGTGATGGACAGTTTGAGGGTTTGGGTTTCTTTTGGACAGAGGATATCACGGTGCAAGTGCGGACCTTTTCTGCACATCATGTTGATTTGGAGGTTAGTTCTGGACCTGGTGAACCGCGTTGGAGGCTTACAGGCTTCTATGGCTATGCCAGAACTTGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

98

Amino Acids

11.23

Weight (kDa)

5.72

Isoelectric Point (pI)

29.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 14
AccII CGCG 1 cut(s) 253
AciI CCGC 2 cut(s) 196, 251
AjnI CCWGG 1 cut(s) 241
Alw21I GWGCWC 1 cut(s) 120
Alw26I GTCTC 1 cut(s) 53
Alw44I GTGCAC 1 cut(s) 116
AoxI GGCC 1 cut(s) 90
ApaLI GTGCAC 1 cut(s) 116
AspLEI GCGC 1 cut(s) 15
AspS9I GGNCC 4 cut(s) 91, 130, 198, 239
AsuHPI GGTGA 1 cut(s) 257
AvaII GGWCC 3 cut(s) 130, 198, 239
BaeGI GKGCMC 1 cut(s) 120
Bbv12I GWGCWC 1 cut(s) 120
BccI CCATC 1 cut(s) 134
BcgI CGANNNNNNTGC 2 cut(s) 4, 38
BciT130I CCWGG 1 cut(s) 243
BcoDI GTCTC 1 cut(s) 53
Bme1390I CCNGG 1 cut(s) 243
Bme18I GGWCC 3 cut(s) 130, 198, 239
BmgT120I GGNCC 4 cut(s) 91, 130, 198, 239
BmrFI CCNGG 1 cut(s) 243
BseBI CCWGG 1 cut(s) 243
BseMII CTCAG 1 cut(s) 125
BseSI GKGCMC 1 cut(s) 120
BsgI GTGCAG 1 cut(s) 192
Bsh1236I CGCG 1 cut(s) 253
BshFI GGCC 1 cut(s) 92
BsiHKAI GWGCWC 1 cut(s) 120
BsmAI GTCTC 1 cut(s) 53
BsnI GGCC 1 cut(s) 92
Bsp1286I GDGCHC 1 cut(s) 120
Bsp143I GATC 1 cut(s) 21
BspACI CCGC 2 cut(s) 196, 251
BspANI GGCC 1 cut(s) 92
BspCNI CTCAG 1 cut(s) 126
BspFNI CGCG 1 cut(s) 253
BssMI GATC 1 cut(s) 21
Bst2UI CCWGG 1 cut(s) 243
Bst4CI ACNGT 3 cut(s) 71, 147, 187
BstDEI CTNAG 1 cut(s) 134
BstFNI CGCG 1 cut(s) 253
BstHHI GCGC 1 cut(s) 15
BstKTI GATC 1 cut(s) 24
BstMAI GTCTC 1 cut(s) 53
BstMBI GATC 1 cut(s) 21
BstMWI GCNNNNNNNGC 2 cut(s) 259, 276
BstNI CCWGG 1 cut(s) 243
BstSCI CCNGG 1 cut(s) 241
BstSLI GKGCMC 1 cut(s) 120
BstUI CGCG 1 cut(s) 253
BsuRI GGCC 1 cut(s) 92
CfoI GCGC 1 cut(s) 15
Cfr13I GGNCC 4 cut(s) 91, 130, 198, 239
CsiI ACCWGGT 1 cut(s) 241
CviAII CATG 1 cut(s) 215
CviJI RGCY 5 cut(s) 8, 92, 262, 270, 279
CviKI_1 RGCY 5 cut(s) 8, 92, 262, 270, 279
DdeI CTNAG 1 cut(s) 134
DpnI GATC 1 cut(s) 23
DpnII GATC 1 cut(s) 21
Eco32I GATATC 1 cut(s) 181
Eco47I GGWCC 3 cut(s) 130, 198, 239
EcoO109I RGGNCCY 2 cut(s) 91, 130
EcoRII CCWGG 1 cut(s) 241
EcoRV GATATC 1 cut(s) 181
FaeI CATG 1 cut(s) 218
FaiI YATR 5 cut(s) 55, 123, 216, 276, 282
FatI CATG 1 cut(s) 214
FspI TGCGCA 1 cut(s) 14
GlaI GCGC 1 cut(s) 14
HaeIII GGCC 1 cut(s) 92
HhaI GCGC 1 cut(s) 15
Hin1II CATG 1 cut(s) 218
Hin6I GCGC 1 cut(s) 13
HinP1I GCGC 1 cut(s) 13
HphI GGTGA 1 cut(s) 257
Hpy166II GTNNAC 2 cut(s) 118, 248
Hpy188I TCNGA 1 cut(s) 75
Hpy188III TCNNGA 2 cut(s) 133, 237
Hpy8I GTNNAC 2 cut(s) 118, 248
HpyCH4III ACNGT 3 cut(s) 71, 147, 187
HpyCH4V TGCA 4 cut(s) 97, 118, 190, 209
HpyF10VI GCNNNNNNNGC 2 cut(s) 259, 276
HpyF3I CTNAG 1 cut(s) 134
Hsp92II CATG 1 cut(s) 218
HspAI GCGC 1 cut(s) 13
Kzo9I GATC 1 cut(s) 21
LpnPI CCDG 6 cut(s) 107, 146, 222, 228, 252, 255
MabI ACCWGGT 1 cut(s) 241
MalI GATC 1 cut(s) 23
MboI GATC 1 cut(s) 21
MhlI GDGCHC 1 cut(s) 120
MluCI AATT 2 cut(s) 16, 104
MmeI TCCRAC 1 cut(s) 236
MnlI CCTC 6 cut(s) 48, 121, 145, 169, 220, 252
MseI TTAA 2 cut(s) 87, 295
MspR9I CCNGG 1 cut(s) 243
MvaI CCWGG 1 cut(s) 243
MvnI CGCG 1 cut(s) 253
MwoI GCNNNNNNNGC 2 cut(s) 259, 276
NdeII GATC 1 cut(s) 21
NlaIII CATG 1 cut(s) 218
NsbI TGCGCA 1 cut(s) 14
PpuMI RGGWCCY 1 cut(s) 130
Psp5II RGGWCCY 1 cut(s) 130
Psp6I CCWGG 1 cut(s) 241
PspGI CCWGG 1 cut(s) 241
PspPI GGNCC 4 cut(s) 91, 130, 198, 239
PspPPI RGGWCCY 1 cut(s) 130
SaqAI TTAA 2 cut(s) 87, 295
Sau3AI GATC 1 cut(s) 21
Sau96I GGNCC 4 cut(s) 91, 130, 198, 239
ScrFI CCNGG 1 cut(s) 243
SduI GDGCHC 1 cut(s) 120
SetI ASST 5 cut(s) 40, 132, 203, 231, 244
SexAI ACCWGGT 1 cut(s) 241
SinI GGWCC 3 cut(s) 130, 198, 239
Sse9I AATT 2 cut(s) 16, 104
SsiI CCGC 2 cut(s) 196, 251
StyD4I CCNGG 1 cut(s) 241
TaaI ACNGT 3 cut(s) 71, 147, 187
TasI AATT 2 cut(s) 16, 104
Tru1I TTAA 2 cut(s) 87, 295
Tru9I TTAA 2 cut(s) 87, 295
VneI GTGCAC 1 cut(s) 116
VpaK11BI GGWCC 3 cut(s) 130, 198, 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.