Rh3AG070600

Ataxin 2 SM domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Forward (+)
5140519 .. 5141642
1124 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG070600.1

Sequence Viewer

Length: 213 bp
ATGAATACGGGAGTTTTACTTCCAGCTGATGGTGTTGCTGGAAATATGTCTGGTGACAGAACTAAAGCTATTATGGGTACTGTTTCTTCTTATGAGTGTTCAAAGGTACTAATGCAAAATGGGAATAGCTTTCATGGTGTTACACCCACAAGGGCTGGCAATGAACATGGAGGGAGGAATATGCCATTGAATCATATTGAGAATGCGTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

7.3

Weight (kDa)

6.81

Isoelectric Point (pI)

32.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 29
AfaI GTAC 2 cut(s) 79, 108
AfiI CCNNNNNNNGG 1 cut(s) 29
AgsI TTSAA 2 cut(s) 102, 190
AluBI AGCT 3 cut(s) 26, 68, 129
AluI AGCT 3 cut(s) 26, 68, 129
AsuHPI GGTGA 1 cut(s) 65
BarI GAAGNNNNNNTAC 2 cut(s) 70, 102
BccI CCATC 1 cut(s) 23
Bsc4I CCNNNNNNNGG 1 cut(s) 29
Bse3DI GCAATG 1 cut(s) 166
BseLI CCNNNNNNNGG 1 cut(s) 29
BseMI GCAATG 1 cut(s) 166
BslI CCNNNNNNNGG 1 cut(s) 29
BsmI GAATGC 1 cut(s) 208
BsrDI GCAATG 1 cut(s) 166
Bst4CI ACNGT 1 cut(s) 82
BstC8I GCNNGC 1 cut(s) 157
Cac8I GCNNGC 1 cut(s) 157
CseI GACGC 1 cut(s) 195
Csp6I GTAC 2 cut(s) 78, 107
CviAII CATG 2 cut(s) 134, 167
CviJI RGCY 4 cut(s) 26, 68, 129, 155
CviKI_1 RGCY 4 cut(s) 26, 68, 129, 155
CviQI GTAC 2 cut(s) 78, 107
FaeI CATG 2 cut(s) 137, 170
FaiI YATR 8 cut(s) 47, 74, 93, 135, 168, 182, 195, 211
FatI CATG 2 cut(s) 133, 166
HgaI GACGC 1 cut(s) 195
Hin1II CATG 2 cut(s) 137, 170
HinfI GANTC 1 cut(s) 190
HphI GGTGA 1 cut(s) 65
HpyCH4III ACNGT 1 cut(s) 82
HpyCH4V TGCA 1 cut(s) 115
Hsp92II CATG 2 cut(s) 137, 170
LpnPI CCDG 4 cut(s) 24, 36, 36, 141
MaeIII GTNAC 2 cut(s) 53, 139
MboII GAAGA 1 cut(s) 78
MnlI CCTC 2 cut(s) 164, 168
MspA1I CMGCKG 1 cut(s) 26
Mva1269I GAATGC 1 cut(s) 208
NlaIII CATG 2 cut(s) 137, 170
NmuCI GTSAC 1 cut(s) 53
PctI GAATGC 1 cut(s) 208
PfeI GAWTC 1 cut(s) 190
PflMI CCANNNNNTGG 1 cut(s) 29
PvuII CAGCTG 1 cut(s) 26
RsaI GTAC 2 cut(s) 79, 108
RsaNI GTAC 2 cut(s) 78, 107
SetI ASST 4 cut(s) 28, 70, 108, 131
SgeI CNNG 8 cut(s) 21, 35, 51, 63, 146, 162, 168, 179
TaaI ACNGT 1 cut(s) 82
TfiI GAWTC 1 cut(s) 190
TseFI GTSAC 1 cut(s) 53
Tsp45I GTSAC 1 cut(s) 53
TspDTI ATGAA 3 cut(s) 17, 122, 177
Van91I CCANNNNNTGG 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.