Rorug04G0235100

GEM-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
OG0004816
Physical Location & Seq
Forward (+)
40098383 .. 40098700
318 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0235100.1

Sequence Viewer

Length: 318 bp
ATGAATTTCGATGGTGCTACTGATGTGAAGAATGGGGTCTGTGGGCTGGGAGTAGTTTTCCGAGACCATTTAGGACATCTACGAGGGGCTATGGCTGTTCCCCAGGTTGGTAATATCTCACCAAGGGCTGTTGAATCGTTGGCACTACTACATGGTCTCAGGTTTGCTCTACATGTTGGTTATTTAAGTTTAGAAGTAGAGGGGGATGCGCTAACAGTCTTAAATACCTTGCATGATGACAGTGGTGATCTTAGTTCGGAAGGTCATATATTAGATGAAGTTAAACAGTTAGTTTTATCTTTTACTAGTTGTAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GRAM

Protein Analysis

105

Amino Acids

11.13

Weight (kDa)

5.08

Isoelectric Point (pI)

34.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 2 - 105 1.9e-17 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 4
AfiI CCNNNNNNNGG 1 cut(s) 107
AflIII ACRYGT 1 cut(s) 172
AgsI TTSAA 1 cut(s) 134
AhlI ACTAGT 1 cut(s) 305
AjnI CCWGG 1 cut(s) 102
Alw26I GTCTC 2 cut(s) 57, 161
ApoI RAATTY 1 cut(s) 4
AspLEI GCGC 1 cut(s) 211
AsuHPI GGTGA 2 cut(s) 111, 257
BccI CCATC 1 cut(s) 5
BciT130I CCWGG 1 cut(s) 104
BcoDI GTCTC 2 cut(s) 57, 161
BcuI ACTAGT 1 cut(s) 305
BfaI CTAG 1 cut(s) 306
Bme1390I CCNGG 1 cut(s) 104
BmrFI CCNGG 1 cut(s) 104
BmsI GCATC 1 cut(s) 196
BsaI GGTCTC 2 cut(s) 57, 161
BsaJI CCNNGG 2 cut(s) 102, 122
Bsc4I CCNNNNNNNGG 1 cut(s) 107
BseBI CCWGG 1 cut(s) 104
BseDI CCNNGG 2 cut(s) 102, 122
BseGI GGATG 1 cut(s) 211
BseLI CCNNNNNNNGG 1 cut(s) 107
BseMII CTCAG 1 cut(s) 172
BseYI CCCAGC 1 cut(s) 46
BslI CCNNNNNNNGG 1 cut(s) 107
BsmAI GTCTC 2 cut(s) 57, 161
Bso31I GGTCTC 2 cut(s) 57, 161
Bsp143I GATC 1 cut(s) 247
BspCNI CTCAG 1 cut(s) 171
BspTNI GGTCTC 2 cut(s) 57, 161
BssECI CCNNGG 2 cut(s) 102, 122
BssMI GATC 1 cut(s) 247
BssT1I CCWWGG 1 cut(s) 122
Bst2UI CCWGG 1 cut(s) 104
Bst4CI ACNGT 3 cut(s) 217, 242, 288
BstDEI CTNAG 2 cut(s) 158, 251
BstF5I GGATG 1 cut(s) 211
BstHHI GCGC 1 cut(s) 211
BstKTI GATC 1 cut(s) 250
BstMAI GTCTC 2 cut(s) 57, 161
BstMBI GATC 1 cut(s) 247
BstNI CCWGG 1 cut(s) 104
BstNSI RCATGY 1 cut(s) 176
BstSCI CCNGG 1 cut(s) 102
BtsCI GGATG 1 cut(s) 211
BtsIMutI CAGTG 1 cut(s) 247
CfoI GCGC 1 cut(s) 211
CviAII CATG 3 cut(s) 152, 173, 233
CviJI RGCY 4 cut(s) 46, 89, 95, 128
CviKI_1 RGCY 4 cut(s) 46, 89, 95, 128
DdeI CTNAG 2 cut(s) 158, 251
DpnI GATC 1 cut(s) 249
DpnII GATC 1 cut(s) 247
Eco130I CCWWGG 1 cut(s) 122
Eco31I GGTCTC 2 cut(s) 57, 161
EcoRII CCWGG 1 cut(s) 102
EcoT14I CCWWGG 1 cut(s) 122
ErhI CCWWGG 1 cut(s) 122
FaeI CATG 3 cut(s) 155, 176, 236
FaiI YATR 6 cut(s) 92, 153, 174, 234, 267, 269
FatI CATG 3 cut(s) 151, 172, 232
FokI GGATG 1 cut(s) 218
FspBI CTAG 1 cut(s) 306
GlaI GCGC 1 cut(s) 210
GsaI CCCAGC 1 cut(s) 50
HhaI GCGC 1 cut(s) 211
Hin1II CATG 3 cut(s) 155, 176, 236
Hin6I GCGC 1 cut(s) 209
HinP1I GCGC 1 cut(s) 209
HinfI GANTC 1 cut(s) 134
HphI GGTGA 2 cut(s) 111, 257
Hpy188I TCNGA 2 cut(s) 62, 259
HpyAV CCTTC 1 cut(s) 254
HpyCH4III ACNGT 3 cut(s) 217, 242, 288
HpyCH4V TGCA 1 cut(s) 232
HpyF3I CTNAG 2 cut(s) 158, 251
Hsp92II CATG 3 cut(s) 155, 176, 236
HspAI GCGC 1 cut(s) 209
Kzo9I GATC 1 cut(s) 247
LpnPI CCDG 4 cut(s) 32, 89, 116, 145
LweI GCATC 1 cut(s) 196
MaeI CTAG 1 cut(s) 306
MalI GATC 1 cut(s) 249
MboI GATC 1 cut(s) 247
MboII GAAGA 1 cut(s) 40
MluCI AATT 1 cut(s) 4
MnlI CCTC 2 cut(s) 77, 193
MseI TTAA 3 cut(s) 185, 221, 282
MspR9I CCNGG 1 cut(s) 104
MvaI CCWGG 1 cut(s) 104
NdeII GATC 1 cut(s) 247
NlaIII CATG 3 cut(s) 155, 176, 236
NspI RCATGY 1 cut(s) 176
PciI ACATGT 1 cut(s) 172
PfeI GAWTC 1 cut(s) 134
PscI ACATGT 1 cut(s) 172
Psp6I CCWGG 1 cut(s) 102
PspFI CCCAGC 1 cut(s) 46
PspGI CCWGG 1 cut(s) 102
SaqAI TTAA 3 cut(s) 185, 221, 282
Sau3AI GATC 1 cut(s) 247
ScrFI CCNGG 1 cut(s) 104
SetI ASST 4 cut(s) 108, 164, 230, 265
SfaNI GCATC 1 cut(s) 196
SpeI ACTAGT 1 cut(s) 305
Sse9I AATT 1 cut(s) 4
SspMI CTAG 1 cut(s) 306
StyD4I CCNGG 1 cut(s) 102
StyI CCWWGG 1 cut(s) 122
TaaI ACNGT 3 cut(s) 217, 242, 288
TaqI TCGA 1 cut(s) 9
TasI AATT 1 cut(s) 4
TfiI GAWTC 1 cut(s) 134
Tru1I TTAA 3 cut(s) 185, 221, 282
Tru9I TTAA 3 cut(s) 185, 221, 282
TscAI CASTG 1 cut(s) 247
TspDTI ATGAA 2 cut(s) 17, 291
TspRI CASTG 1 cut(s) 247
XapI RAATTY 1 cut(s) 4
XceI RCATGY 1 cut(s) 176
XspI CTAG 1 cut(s) 306
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.