Rorug04G0421200

Telomerase Cajal body protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
58129532 .. 58131556
2025 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0421200.1

Sequence Viewer

Length: 408 bp
ATGGCAGACTTGAAACAAGCACCGAGCAAACCAACCTTCACAAAGGTTATGCAGCTCCGCCCAATGACCTCTGGTGTCACTCTCACTGTAAAGGTTGTTAATACTAAGATAGTATGCCCGAAGGGACGTGCTGGTGGGCCTCGAGGCCAAATGCGAATTGCTGATTGCTTGGTTGGCGATGAAACGGCAATGATAATCTTCACGGCTAGAAACGATCAAGTGGACTTGATGAAAGAGGGTTCGACTGTAACCCTGCGAAATGCCAAAATTGACACGTTTAAAGGATCAATGAGGCTTGCTGTGGACAAAAGTGGCCGTATTGAAGTTGCTGAGCCTGCCAATTTTACCGTGATGGAAAATAACAACCTCTCACTCATTGAATTTGAACGTGTCGATGTCGTTATATGA

Protein Analysis

135

Amino Acids

14.79

Weight (kDa)

9.3

Isoelectric Point (pI)

15.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
OB_Ssb-like PF21473 19 - 109 5.3e-39 Single-stranded DNA binding protein Ssb-like, OB fold
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 141
AciI CCGC 1 cut(s) 58
AclWI GGATC 1 cut(s) 292
AcoI YGGCCR 1 cut(s) 313
AcsI RAATTY 1 cut(s) 380
AflIII ACRYGT 2 cut(s) 273, 388
AgsI TTSAA 4 cut(s) 13, 323, 380, 386
AjiI CACGTC 1 cut(s) 128
AluBI AGCT 1 cut(s) 55
AluI AGCT 1 cut(s) 55
AlwI GGATC 1 cut(s) 292
Ama87I CYCGRG 1 cut(s) 141
AoxI GGCC 3 cut(s) 137, 145, 313
ApeKI GCWGC 1 cut(s) 52
ApoI RAATTY 1 cut(s) 380
AspS9I GGNCC 1 cut(s) 137
AvaI CYCGRG 1 cut(s) 141
BbvI GCAGC 1 cut(s) 64
BccI CCATC 1 cut(s) 346
BceAI ACGGC 3 cut(s) 201, 219, 300
BfaI CTAG 1 cut(s) 207
BisI GCNGC 1 cut(s) 53
BlpI GCTNAGC 1 cut(s) 330
BlsI GCNGC 1 cut(s) 54
BmeT110I CYCGRG 1 cut(s) 141
BmgBI CACGTC 1 cut(s) 128
BmgT120I GGNCC 1 cut(s) 137
Bpu1102I GCTNAGC 1 cut(s) 330
Bse3DI GCAATG 1 cut(s) 195
BseMI GCAATG 1 cut(s) 195
BseMII CTCAG 1 cut(s) 321
BseXI GCAGC 1 cut(s) 64
BshFI GGCC 3 cut(s) 139, 147, 315
BsiHKCI CYCGRG 1 cut(s) 141
BslFI GGGAC 1 cut(s) 138
BsmFI GGGAC 1 cut(s) 138
BsnI GGCC 3 cut(s) 139, 147, 315
BsoBI CYCGRG 1 cut(s) 141
Bsp143I GATC 2 cut(s) 214, 284
Bsp1720I GCTNAGC 1 cut(s) 330
BspACI CCGC 1 cut(s) 58
BspANI GGCC 3 cut(s) 139, 147, 315
BspCNI CTCAG 1 cut(s) 322
BspPI GGATC 1 cut(s) 292
BsrDI GCAATG 1 cut(s) 195
BssMI GATC 2 cut(s) 214, 284
Bst4CI ACNGT 3 cut(s) 88, 247, 349
BstC8I GCNNGC 2 cut(s) 297, 336
BstDEI CTNAG 2 cut(s) 105, 330
BstKTI GATC 2 cut(s) 217, 287
BstMBI GATC 2 cut(s) 214, 284
BstMWI GCNNNNNNNGC 2 cut(s) 174, 335
BstV1I GCAGC 1 cut(s) 64
BsuRI GGCC 3 cut(s) 139, 147, 315
BtgZI GCGATG 1 cut(s) 192
BtrI CACGTC 1 cut(s) 128
BtsIMutI CAGTG 1 cut(s) 84
Cac8I GCNNGC 2 cut(s) 297, 336
Cfr13I GGNCC 1 cut(s) 137
CviJI RGCY 7 cut(s) 55, 139, 147, 206, 295, 315, 334
CviKI_1 RGCY 7 cut(s) 55, 139, 147, 206, 295, 315, 334
DdeI CTNAG 2 cut(s) 105, 330
DpnI GATC 2 cut(s) 216, 286
DpnII GATC 2 cut(s) 214, 284
DraI TTTAAA 1 cut(s) 280
EaeI YGGCCR 1 cut(s) 313
EciI GGCGGA 1 cut(s) 47
Eco88I CYCGRG 1 cut(s) 141
FaiI YATR 4 cut(s) 50, 115, 404, 406
FaqI GGGAC 1 cut(s) 138
Fnu4HI GCNGC 1 cut(s) 53
Fsp4HI GCNGC 1 cut(s) 53
FspBI CTAG 1 cut(s) 207
GluI GCNGC 1 cut(s) 53
HaeIII GGCC 3 cut(s) 139, 147, 315
Hpy166II GTNNAC 2 cut(s) 223, 304
Hpy8I GTNNAC 2 cut(s) 223, 304
HpyAV CCTTC 2 cut(s) 46, 115
HpyCH4III ACNGT 3 cut(s) 88, 247, 349
HpyCH4IV ACGT 3 cut(s) 127, 275, 388
HpyCH4V TGCA 1 cut(s) 52
HpyF10VI GCNNNNNNNGC 2 cut(s) 174, 335
HpyF3I CTNAG 2 cut(s) 105, 330
HpySE526I ACGT 3 cut(s) 127, 275, 388
Kzo9I GATC 2 cut(s) 214, 284
LmnI GCTCC 1 cut(s) 60
LpnPI CCDG 4 cut(s) 57, 117, 266, 348
Lsp1109I GCAGC 1 cut(s) 64
MaeI CTAG 1 cut(s) 207
MaeII ACGT 3 cut(s) 127, 275, 388
MaeIII GTNAC 2 cut(s) 76, 247
MalI GATC 2 cut(s) 216, 286
MboI GATC 2 cut(s) 214, 284
MboII GAAGA 1 cut(s) 190
MluCI AATT 4 cut(s) 156, 267, 340, 380
MnlI CCTC 6 cut(s) 79, 137, 150, 229, 285, 377
MseI TTAA 2 cut(s) 99, 279
MwoI GCNNNNNNNGC 2 cut(s) 174, 335
NdeII GATC 2 cut(s) 214, 284
NmuCI GTSAC 1 cut(s) 76
PaeR7I CTCGAG 1 cut(s) 141
PkrI GCNGC 1 cut(s) 54
PspPI GGNCC 1 cut(s) 137
PspXI VCTCGAGB 1 cut(s) 141
SaqAI TTAA 2 cut(s) 99, 279
SatI GCNGC 1 cut(s) 53
Sau3AI GATC 2 cut(s) 214, 284
Sau96I GGNCC 1 cut(s) 137
SetI ASST 9 cut(s) 38, 48, 57, 71, 96, 130, 278, 369, 391
Sfr274I CTCGAG 1 cut(s) 141
SlaI CTCGAG 1 cut(s) 141
SmlI CTYRAG 1 cut(s) 141
SmoI CTYRAG 1 cut(s) 141
Sse9I AATT 4 cut(s) 156, 267, 340, 380
SsiI CCGC 1 cut(s) 58
SspMI CTAG 1 cut(s) 207
TaaI ACNGT 3 cut(s) 88, 247, 349
TaiI ACGT 3 cut(s) 130, 278, 391
TaqI TCGA 3 cut(s) 142, 242, 393
TasI AATT 4 cut(s) 156, 267, 340, 380
Tru1I TTAA 2 cut(s) 99, 279
Tru9I TTAA 2 cut(s) 99, 279
TscAI CASTG 1 cut(s) 91
TseFI GTSAC 1 cut(s) 76
TseI GCWGC 1 cut(s) 52
Tsp45I GTSAC 1 cut(s) 76
TspDTI ATGAA 2 cut(s) 195, 245
TspRI CASTG 1 cut(s) 91
XapI RAATTY 1 cut(s) 380
XhoI CTCGAG 1 cut(s) 141
XspI CTAG 1 cut(s) 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.