Rorug05G0583000

polyadenylate-binding protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Forward (+)
78013942 .. 78014737
796 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0583000.1

Sequence Viewer

Length: 396 bp
ATGTCATCAACACAAAATGCATCCCAAAGTTTAAGCTCCGAATCCGATTCCGATTCCGATTCCATTCATTCCAATTCAAATTCAAAAGCAATCGTTCCAAGACCAACACCAACTCCAACCGATGCTTTGAGGGTTCAGACAATTCCCAAAACATTCAAGGCCCAGAAGAAAAAGCGAGCTGTTGGGGGAAAGAGAAAGCGAGCTGCAGATGCAGAGGAAGAGGAAGGAGAAAAGTCTGAAAAACCAGCTGGAAGATCCTGGGTGTGGGAGCACTTCAAGAAGATCGACAAGCCTGTATTCGAGCTTGAATTCTTGAAACTTAAAGCATTTGGAGCAGTTGCAGCAGCTGGAGTTGGTGATGAAAGCATGTGGAGCAGCTGGACCCAGCTGCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

131

Amino Acids

14.41

Weight (kDa)

9.19

Isoelectric Point (pI)

47.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 249
AcsI RAATTY 2 cut(s) 79, 308
AfiI CCNNNNNNNGG 1 cut(s) 264
AgsI TTSAA 6 cut(s) 78, 84, 157, 277, 308, 316
AjnI CCWGG 1 cut(s) 257
AluBI AGCT 8 cut(s) 36, 179, 203, 248, 304, 347, 378, 388
AluI AGCT 8 cut(s) 36, 179, 203, 248, 304, 347, 378, 388
Alw21I GWGCWC 1 cut(s) 273
AlwI GGATC 1 cut(s) 249
AlwNI CAGNNNCTG 1 cut(s) 347
AoxI GGCC 1 cut(s) 159
ApeKI GCWGC 5 cut(s) 203, 341, 344, 375, 388
ApoI RAATTY 2 cut(s) 79, 308
AspS9I GGNCC 2 cut(s) 160, 381
AsuHPI GGTGA 1 cut(s) 368
AvaII GGWCC 1 cut(s) 381
Bbv12I GWGCWC 1 cut(s) 273
BbvI GCAGC 5 cut(s) 190, 353, 356, 375, 387
BciT130I CCWGG 1 cut(s) 259
BfmI CTRYAG 2 cut(s) 204, 389
BisI GCNGC 5 cut(s) 204, 342, 345, 376, 389
BlsI GCNGC 5 cut(s) 205, 343, 346, 377, 390
Bme1390I CCNGG 1 cut(s) 259
Bme18I GGWCC 1 cut(s) 381
BmgT120I GGNCC 2 cut(s) 160, 381
BmiI GGNNCC 1 cut(s) 383
BmrFI CCNGG 1 cut(s) 259
BmsI GCATC 3 cut(s) 29, 112, 199
BpmI CTGGAG 1 cut(s) 369
BsaJI CCNNGG 1 cut(s) 258
BsaXI ACNNNNNCTCC 2 cut(s) 97, 127
Bsc4I CCNNNNNNNGG 1 cut(s) 264
BseBI CCWGG 1 cut(s) 259
BseDI CCNNGG 1 cut(s) 258
BseGI GGATG 1 cut(s) 20
BseLI CCNNNNNNNGG 1 cut(s) 264
BseXI GCAGC 5 cut(s) 190, 353, 356, 375, 387
BseYI CCCAGC 1 cut(s) 384
BshFI GGCC 1 cut(s) 161
BsiHKAI GWGCWC 1 cut(s) 273
BslI CCNNNNNNNGG 1 cut(s) 264
BsnI GGCC 1 cut(s) 161
Bsp1286I GDGCHC 1 cut(s) 273
Bsp143I GATC 2 cut(s) 254, 282
BspANI GGCC 1 cut(s) 161
BspLI GGNNCC 1 cut(s) 383
BspMAI CTGCAG 2 cut(s) 208, 393
BspPI GGATC 1 cut(s) 249
BssECI CCNNGG 1 cut(s) 258
BssMI GATC 2 cut(s) 254, 282
Bst2UI CCWGG 1 cut(s) 259
Bst6I CTCTTC 1 cut(s) 213
BstC8I GCNNGC 2 cut(s) 177, 201
BstF5I GGATG 1 cut(s) 20
BstKTI GATC 2 cut(s) 257, 285
BstMBI GATC 2 cut(s) 254, 282
BstMWI GCNNNNNNNGC 4 cut(s) 209, 332, 341, 372
BstNI CCWGG 1 cut(s) 259
BstNSI RCATGY 1 cut(s) 370
BstSCI CCNGG 1 cut(s) 257
BstSFI CTRYAG 2 cut(s) 204, 389
BstV1I GCAGC 5 cut(s) 190, 353, 356, 375, 387
BstX2I RGATCY 1 cut(s) 254
BstYI RGATCY 1 cut(s) 254
BsuRI GGCC 1 cut(s) 161
BtsCI GGATG 1 cut(s) 20
Cac8I GCNNGC 2 cut(s) 177, 201
CaiI CAGNNNCTG 1 cut(s) 347
Cfr13I GGNCC 2 cut(s) 160, 381
CviAII CATG 1 cut(s) 367
DpnI GATC 2 cut(s) 256, 284
DpnII GATC 2 cut(s) 254, 282
Eam1104I CTCTTC 1 cut(s) 213
EarI CTCTTC 1 cut(s) 213
Eco47I GGWCC 1 cut(s) 381
EcoRI GAATTC 1 cut(s) 308
EcoRII CCWGG 1 cut(s) 257
EcoT22I ATGCAT 1 cut(s) 22
FaeI CATG 1 cut(s) 370
FaiI YATR 1 cut(s) 368
FatI CATG 1 cut(s) 366
Fnu4HI GCNGC 5 cut(s) 204, 342, 345, 376, 389
FokI GGATG 1 cut(s) 7
Fsp4HI GCNGC 5 cut(s) 204, 342, 345, 376, 389
GluI GCNGC 5 cut(s) 204, 342, 345, 376, 389
GsaI CCCAGC 1 cut(s) 388
GsuI CTGGAG 1 cut(s) 369
HaeIII GGCC 1 cut(s) 161
Hin1II CATG 1 cut(s) 370
HinfI GANTC 4 cut(s) 41, 47, 53, 59
HphI GGTGA 1 cut(s) 368
Hpy188I TCNGA 6 cut(s) 40, 46, 52, 58, 138, 238
Hpy188III TCNNGA 2 cut(s) 277, 313
HpyAV CCTTC 1 cut(s) 218
HpyCH4V TGCA 5 cut(s) 20, 206, 212, 341, 391
HpyF10VI GCNNNNNNNGC 4 cut(s) 209, 332, 341, 372
Hsp92II CATG 1 cut(s) 370
Kzo9I GATC 2 cut(s) 254, 282
LmnI GCTCC 4 cut(s) 41, 268, 332, 372
LpnPI CCDG 8 cut(s) 176, 234, 244, 258, 271, 306, 333, 364
Lsp1109I GCAGC 5 cut(s) 190, 353, 356, 375, 387
LweI GCATC 3 cut(s) 29, 112, 199
MalI GATC 2 cut(s) 256, 284
MboI GATC 2 cut(s) 254, 282
MboII GAAGA 4 cut(s) 178, 230, 264, 292
MflI RGATCY 1 cut(s) 254
MhlI GDGCHC 1 cut(s) 273
MluCI AATT 4 cut(s) 73, 79, 141, 308
MmeI TCCRAC 1 cut(s) 140
MnlI CCTC 3 cut(s) 123, 208, 214
Mph1103I ATGCAT 1 cut(s) 22
MseI TTAA 2 cut(s) 32, 321
MspA1I CMGCKG 4 cut(s) 248, 347, 378, 388
MspR9I CCNGG 1 cut(s) 259
MvaI CCWGG 1 cut(s) 259
MwoI GCNNNNNNNGC 4 cut(s) 209, 332, 341, 372
NdeII GATC 2 cut(s) 254, 282
NlaIII CATG 1 cut(s) 370
NlaIV GGNNCC 1 cut(s) 383
NsiI ATGCAT 1 cut(s) 22
NspI RCATGY 1 cut(s) 370
PfeI GAWTC 4 cut(s) 41, 47, 53, 59
PkrI GCNGC 5 cut(s) 205, 343, 346, 377, 390
Psp6I CCWGG 1 cut(s) 257
PspFI CCCAGC 1 cut(s) 384
PspGI CCWGG 1 cut(s) 257
PspN4I GGNNCC 1 cut(s) 383
PspPI GGNCC 2 cut(s) 160, 381
PstI CTGCAG 2 cut(s) 208, 393
PstNI CAGNNNCTG 1 cut(s) 347
PsuI RGATCY 1 cut(s) 254
PvuII CAGCTG 4 cut(s) 248, 347, 378, 388
SaqAI TTAA 2 cut(s) 32, 321
SatI GCNGC 5 cut(s) 204, 342, 345, 376, 389
Sau3AI GATC 2 cut(s) 254, 282
Sau96I GGNCC 2 cut(s) 160, 381
ScrFI CCNGG 1 cut(s) 259
SduI GDGCHC 1 cut(s) 273
SetI ASST 8 cut(s) 38, 181, 205, 250, 306, 349, 380, 390
SfaNI GCATC 3 cut(s) 29, 112, 199
SfcI CTRYAG 2 cut(s) 204, 389
SinI GGWCC 1 cut(s) 381
Sse9I AATT 4 cut(s) 73, 79, 141, 308
StyD4I CCNGG 1 cut(s) 257
TaqI TCGA 2 cut(s) 285, 300
TasI AATT 4 cut(s) 73, 79, 141, 308
TfiI GAWTC 4 cut(s) 41, 47, 53, 59
Tru1I TTAA 2 cut(s) 32, 321
Tru9I TTAA 2 cut(s) 32, 321
TseI GCWGC 5 cut(s) 203, 341, 344, 375, 388
TspDTI ATGAA 2 cut(s) 56, 375
VpaK11BI GGWCC 1 cut(s) 381
XapI RAATTY 2 cut(s) 79, 308
XceI RCATGY 1 cut(s) 370
Zsp2I ATGCAT 1 cut(s) 22
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.