Rh2AG302200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0007553
Physical Location & Seq
Reverse (-)
37825661 .. 37827580
1920 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG302200.1

Sequence Viewer

Length: 234 bp
ATGTACATCGGCAAGGATACAAGAACAGATTTTCAAAATCCAGGACCAGTCCACGACAAGCTGCTTCCCTGCATTGTTCTTTCAGGCATTTCTCTGCCCTTTGGATTCCTAACAAATGAGGGAGATGACTGTCCCATGACCAAGCTGCCAGAAATCAACTTTGAGGCTCTGTTTTGGTGCAAAACTCCTAGAGAAATGAAGCTTATTTTTAGGCTCATGTTGTTATTAAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.82

Weight (kDa)

5.65

Isoelectric Point (pI)

14.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 5
AgsI TTSAA 1 cut(s) 35
AjnI CCWGG 1 cut(s) 40
AluBI AGCT 3 cut(s) 61, 145, 202
AluI AGCT 3 cut(s) 61, 145, 202
ApeKI GCWGC 2 cut(s) 61, 145
AspS9I GGNCC 1 cut(s) 44
AvaII GGWCC 1 cut(s) 44
BbvI GCAGC 2 cut(s) 48, 132
BciT130I CCWGG 1 cut(s) 42
BciVI GTATCC 1 cut(s) 10
BfaI CTAG 1 cut(s) 189
BfuI GTATCC 1 cut(s) 10
BisI GCNGC 2 cut(s) 62, 146
BlsI GCNGC 2 cut(s) 63, 147
Bme1390I CCNGG 1 cut(s) 42
Bme18I GGWCC 1 cut(s) 44
BmgT120I GGNCC 1 cut(s) 44
BmrFI CCNGG 1 cut(s) 42
Bse1I ACTGG 1 cut(s) 47
BseBI CCWGG 1 cut(s) 42
BseNI ACTGG 1 cut(s) 47
BseXI GCAGC 2 cut(s) 48, 132
BslFI GGGAC 1 cut(s) 117
BsmFI GGGAC 1 cut(s) 117
Bsp1407I TGTACA 1 cut(s) 3
BsrGI TGTACA 1 cut(s) 3
BsrI ACTGG 1 cut(s) 47
Bst2UI CCWGG 1 cut(s) 42
Bst4CI ACNGT 1 cut(s) 131
BstAUI TGTACA 1 cut(s) 3
BstNI CCWGG 1 cut(s) 42
BstSCI CCNGG 1 cut(s) 40
BstV1I GCAGC 2 cut(s) 48, 132
BsuI GTATCC 1 cut(s) 10
Cfr13I GGNCC 1 cut(s) 44
Csp6I GTAC 1 cut(s) 4
CviAII CATG 2 cut(s) 136, 217
CviJI RGCY 5 cut(s) 61, 145, 167, 202, 214
CviKI_1 RGCY 5 cut(s) 61, 145, 167, 202, 214
CviQI GTAC 1 cut(s) 4
Eco47I GGWCC 1 cut(s) 44
EcoRII CCWGG 1 cut(s) 40
FaeI CATG 2 cut(s) 139, 220
FaiI YATR 2 cut(s) 137, 218
FaqI GGGAC 1 cut(s) 117
FatI CATG 2 cut(s) 135, 216
Fnu4HI GCNGC 2 cut(s) 62, 146
Fsp4HI GCNGC 2 cut(s) 62, 146
FspBI CTAG 1 cut(s) 189
GluI GCNGC 2 cut(s) 62, 146
Hin1II CATG 2 cut(s) 139, 220
HindIII AAGCTT 1 cut(s) 200
HinfI GANTC 1 cut(s) 105
Hpy166II GTNNAC 1 cut(s) 52
Hpy8I GTNNAC 1 cut(s) 52
HpyCH4III ACNGT 1 cut(s) 131
HpyCH4V TGCA 2 cut(s) 72, 180
Hsp92II CATG 2 cut(s) 139, 220
LpnPI CCDG 6 cut(s) 27, 54, 60, 69, 82, 162
Lsp1109I GCAGC 2 cut(s) 48, 132
MaeI CTAG 1 cut(s) 189
MnlI CCTC 2 cut(s) 112, 157
MseI TTAA 1 cut(s) 227
MspR9I CCNGG 1 cut(s) 42
MvaI CCWGG 1 cut(s) 42
NlaIII CATG 2 cut(s) 139, 220
PfeI GAWTC 1 cut(s) 105
PfoI TCCNGGA 1 cut(s) 40
PkrI GCNGC 2 cut(s) 63, 147
Psp6I CCWGG 1 cut(s) 40
PspGI CCWGG 1 cut(s) 40
PspPI GGNCC 1 cut(s) 44
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 227
SatI GCNGC 2 cut(s) 62, 146
Sau96I GGNCC 1 cut(s) 44
ScrFI CCNGG 1 cut(s) 42
SetI ASST 3 cut(s) 63, 147, 204
SinI GGWCC 1 cut(s) 44
SspMI CTAG 1 cut(s) 189
StyD4I CCNGG 1 cut(s) 40
TaaI ACNGT 1 cut(s) 131
TatI WGTACW 1 cut(s) 3
TfiI GAWTC 1 cut(s) 105
Tru1I TTAA 1 cut(s) 227
Tru9I TTAA 1 cut(s) 227
TseI GCWGC 2 cut(s) 61, 145
TspDTI ATGAA 1 cut(s) 212
VpaK11BI GGWCC 1 cut(s) 44
XspI CTAG 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.