Rh3CG289800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0003441
Physical Location & Seq
Reverse (-)
29376875 .. 29378372
1498 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG289800.1

Sequence Viewer

Length: 267 bp
ATGGCGCAACCTGAGAATCCTGTCATCCTGGACCAGACGTTGAATCCCTTTTACCAGAGGGCCTCCGAAGCCGAGGACCGCTTAACAAGACTTGAAGCTGCCCTTGCTAGTAACAAAGATTCTGGAAATAAGGATCATTCAAAGTTGATCAGTGAACTCCAAGAAGAGAACAAGAAGCTCGCTGCAGAGAATGCAAAGCTCCAGTACCGCATAAACCACCTTGTTCAGGCAGTCAGAGATGCTGATGTCAAGTTAGAGAAAAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

10.0

Weight (kDa)

6.1

Isoelectric Point (pI)

45.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 79, 208
AclWI GGATC 1 cut(s) 141
AfaI GTAC 1 cut(s) 206
AfiI CCNNNNNNNGG 1 cut(s) 226
AgsI TTSAA 3 cut(s) 43, 95, 141
AjnI CCWGG 1 cut(s) 27
AluBI AGCT 3 cut(s) 98, 178, 199
AluI AGCT 3 cut(s) 98, 178, 199
AlwI GGATC 1 cut(s) 141
AoxI GGCC 1 cut(s) 60
ApeKI GCWGC 2 cut(s) 98, 182
AspLEI GCGC 1 cut(s) 7
AspS9I GGNCC 3 cut(s) 31, 60, 76
AvaII GGWCC 2 cut(s) 31, 76
BbvI GCAGC 2 cut(s) 85, 169
BciT130I CCWGG 1 cut(s) 29
BclI TGATCA 1 cut(s) 147
BfaI CTAG 1 cut(s) 108
BfmI CTRYAG 1 cut(s) 183
BisI GCNGC 2 cut(s) 99, 183
BlsI GCNGC 2 cut(s) 100, 184
Bme1390I CCNGG 1 cut(s) 29
Bme18I GGWCC 2 cut(s) 31, 76
BmgT120I GGNCC 3 cut(s) 31, 60, 76
BmrFI CCNGG 1 cut(s) 29
BmsI GCATC 1 cut(s) 229
BpmI CTGGAG 1 cut(s) 185
BsaJI CCNNGG 1 cut(s) 72
Bsc4I CCNNNNNNNGG 1 cut(s) 226
Bse1I ACTGG 1 cut(s) 202
BseBI CCWGG 1 cut(s) 29
BseDI CCNNGG 1 cut(s) 72
BseGI GGATG 1 cut(s) 24
BseLI CCNNNNNNNGG 1 cut(s) 226
BseNI ACTGG 1 cut(s) 202
BseXI GCAGC 2 cut(s) 85, 169
BshFI GGCC 1 cut(s) 62
BslI CCNNNNNNNGG 1 cut(s) 226
BsmI GAATGC 1 cut(s) 196
BsnI GGCC 1 cut(s) 62
Bsp143I GATC 2 cut(s) 133, 147
BspACI CCGC 2 cut(s) 79, 208
BspANI GGCC 1 cut(s) 62
BspCNI CTCAG 1 cut(s) 4
BspMAI CTGCAG 1 cut(s) 187
BspPI GGATC 1 cut(s) 141
BsrI ACTGG 1 cut(s) 202
BssECI CCNNGG 1 cut(s) 72
BssMI GATC 2 cut(s) 133, 147
Bst2UI CCWGG 1 cut(s) 29
Bst6I CTCTTC 1 cut(s) 159
BstAPI GCANNNNNTGC 1 cut(s) 191
BstC8I GCNNGC 1 cut(s) 180
BstDEI CTNAG 1 cut(s) 12
BstENI CCTNNNNNAGG 1 cut(s) 224
BstF5I GGATG 1 cut(s) 24
BstHHI GCGC 1 cut(s) 7
BstKTI GATC 2 cut(s) 136, 150
BstMBI GATC 2 cut(s) 133, 147
BstMWI GCNNNNNNNGC 3 cut(s) 68, 104, 191
BstNI CCWGG 1 cut(s) 29
BstSCI CCNGG 1 cut(s) 27
BstSFI CTRYAG 1 cut(s) 183
BstV1I GCAGC 2 cut(s) 85, 169
BsuRI GGCC 1 cut(s) 62
BtsCI GGATG 1 cut(s) 24
BtsIMutI CAGTG 1 cut(s) 157
Cac8I GCNNGC 1 cut(s) 180
CfoI GCGC 1 cut(s) 7
Cfr13I GGNCC 3 cut(s) 31, 60, 76
Csp6I GTAC 1 cut(s) 205
CviJI RGCY 5 cut(s) 62, 71, 98, 178, 199
CviKI_1 RGCY 5 cut(s) 62, 71, 98, 178, 199
CviQI GTAC 1 cut(s) 205
DdeI CTNAG 1 cut(s) 12
DpnI GATC 2 cut(s) 135, 149
DpnII GATC 2 cut(s) 133, 147
Eam1104I CTCTTC 1 cut(s) 159
EarI CTCTTC 1 cut(s) 159
Eco47I GGWCC 2 cut(s) 31, 76
EcoNI CCTNNNNNAGG 1 cut(s) 224
EcoO109I RGGNCCY 1 cut(s) 60
EcoRII CCWGG 1 cut(s) 27
FaiI YATR 1 cut(s) 212
FalI AAGNNNNNCTT 2 cut(s) 87, 119
FbaI TGATCA 1 cut(s) 147
Fnu4HI GCNGC 2 cut(s) 99, 183
FokI GGATG 1 cut(s) 11
Fsp4HI GCNGC 2 cut(s) 99, 183
FspBI CTAG 1 cut(s) 108
GlaI GCGC 1 cut(s) 6
GluI GCNGC 2 cut(s) 99, 183
GsuI CTGGAG 1 cut(s) 185
HaeIII GGCC 1 cut(s) 62
HhaI GCGC 1 cut(s) 7
Hin6I GCGC 1 cut(s) 5
HinP1I GCGC 1 cut(s) 5
HinfI GANTC 3 cut(s) 16, 43, 119
Hpy166II GTNNAC 1 cut(s) 155
Hpy188I TCNGA 2 cut(s) 67, 236
Hpy188III TCNNGA 1 cut(s) 123
Hpy8I GTNNAC 1 cut(s) 155
HpyCH4IV ACGT 1 cut(s) 38
HpyCH4V TGCA 2 cut(s) 185, 194
HpyF10VI GCNNNNNNNGC 3 cut(s) 68, 104, 191
HpyF3I CTNAG 1 cut(s) 12
HpySE526I ACGT 1 cut(s) 38
HspAI GCGC 1 cut(s) 5
Ksp22I TGATCA 1 cut(s) 147
Kzo9I GATC 2 cut(s) 133, 147
LmnI GCTCC 1 cut(s) 204
LpnPI CCDG 9 cut(s) 14, 24, 33, 41, 47, 68, 108, 212, 215
Lsp1109I GCAGC 2 cut(s) 85, 169
LweI GCATC 1 cut(s) 229
MaeI CTAG 1 cut(s) 108
MaeII ACGT 1 cut(s) 38
MaeIII GTNAC 1 cut(s) 110
MalI GATC 2 cut(s) 135, 149
MboI GATC 2 cut(s) 133, 147
MboII GAAGA 1 cut(s) 176
MnlI CCTC 3 cut(s) 51, 67, 73
MseI TTAA 1 cut(s) 83
MspR9I CCNGG 1 cut(s) 29
Mva1269I GAATGC 1 cut(s) 196
MvaI CCWGG 1 cut(s) 29
MwoI GCNNNNNNNGC 3 cut(s) 68, 104, 191
NdeII GATC 2 cut(s) 133, 147
NmeAIII GCCGAG 1 cut(s) 97
PctI GAATGC 1 cut(s) 196
PfeI GAWTC 3 cut(s) 16, 43, 119
PfoI TCCNGGA 1 cut(s) 27
PkrI GCNGC 2 cut(s) 100, 184
Psp6I CCWGG 1 cut(s) 27
PspGI CCWGG 1 cut(s) 27
PspPI GGNCC 3 cut(s) 31, 60, 76
PstI CTGCAG 1 cut(s) 187
RsaI GTAC 1 cut(s) 206
RsaNI GTAC 1 cut(s) 205
SaqAI TTAA 1 cut(s) 83
SatI GCNGC 2 cut(s) 99, 183
Sau3AI GATC 2 cut(s) 133, 147
Sau96I GGNCC 3 cut(s) 31, 60, 76
ScrFI CCNGG 1 cut(s) 29
SetI ASST 6 cut(s) 13, 41, 100, 180, 201, 222
SfaNI GCATC 1 cut(s) 229
SfcI CTRYAG 1 cut(s) 183
SinI GGWCC 2 cut(s) 31, 76
SsiI CCGC 2 cut(s) 79, 208
SspMI CTAG 1 cut(s) 108
StyD4I CCNGG 1 cut(s) 27
TaiI ACGT 1 cut(s) 41
TfiI GAWTC 3 cut(s) 16, 43, 119
Tru1I TTAA 1 cut(s) 83
Tru9I TTAA 1 cut(s) 83
TscAI CASTG 1 cut(s) 157
TseI GCWGC 2 cut(s) 98, 182
TspRI CASTG 1 cut(s) 157
VpaK11BI GGWCC 2 cut(s) 31, 76
XagI CCTNNNNNAGG 1 cut(s) 224
XspI CTAG 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.