Rh3DG285800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Reverse (-)
29177251 .. 29179432
2182 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG285800.1

Sequence Viewer

Length: 204 bp
ATGGCGCAACCTGAGAATCCTGTCATCCTGGACCAGACGTTGAATCCCTTTTACCAGAGGGCCTCCGAAGCCGAGGACCGCTTAACAAGACTTGAAGCTGCCCTTGCTAGTAACAAAGATTCTGGAAATAAGGATCATTCAAAGTTGATCAGTGAACTCCAAGAAGAGGTATATCATCATTGTATCTGCTTTTGTTTAAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.62

Weight (kDa)

4.93

Isoelectric Point (pI)

60.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 79
AclWI GGATC 1 cut(s) 141
AfiI CCNNNNNNNGG 1 cut(s) 166
AgsI TTSAA 3 cut(s) 43, 95, 141
AjnI CCWGG 1 cut(s) 27
AluBI AGCT 1 cut(s) 98
AluI AGCT 1 cut(s) 98
AlwI GGATC 1 cut(s) 141
AoxI GGCC 1 cut(s) 60
ApeKI GCWGC 1 cut(s) 98
AspLEI GCGC 1 cut(s) 7
AspS9I GGNCC 3 cut(s) 31, 60, 76
AvaII GGWCC 2 cut(s) 31, 76
BbvI GCAGC 1 cut(s) 85
BciT130I CCWGG 1 cut(s) 29
BclI TGATCA 1 cut(s) 147
BfaI CTAG 1 cut(s) 108
BisI GCNGC 1 cut(s) 99
BlsI GCNGC 1 cut(s) 100
Bme1390I CCNGG 1 cut(s) 29
Bme18I GGWCC 2 cut(s) 31, 76
BmgT120I GGNCC 3 cut(s) 31, 60, 76
BmrFI CCNGG 1 cut(s) 29
BsaJI CCNNGG 1 cut(s) 72
Bsc4I CCNNNNNNNGG 1 cut(s) 166
BseBI CCWGG 1 cut(s) 29
BseDI CCNNGG 1 cut(s) 72
BseGI GGATG 1 cut(s) 24
BseLI CCNNNNNNNGG 1 cut(s) 166
BseXI GCAGC 1 cut(s) 85
BshFI GGCC 1 cut(s) 62
BslI CCNNNNNNNGG 1 cut(s) 166
BsnI GGCC 1 cut(s) 62
Bsp143I GATC 2 cut(s) 133, 147
BspACI CCGC 1 cut(s) 79
BspANI GGCC 1 cut(s) 62
BspCNI CTCAG 1 cut(s) 4
BspPI GGATC 1 cut(s) 141
BssECI CCNNGG 1 cut(s) 72
BssMI GATC 2 cut(s) 133, 147
Bst2UI CCWGG 1 cut(s) 29
Bst6I CTCTTC 1 cut(s) 159
BstDEI CTNAG 1 cut(s) 12
BstF5I GGATG 1 cut(s) 24
BstHHI GCGC 1 cut(s) 7
BstKTI GATC 2 cut(s) 136, 150
BstMBI GATC 2 cut(s) 133, 147
BstMWI GCNNNNNNNGC 2 cut(s) 68, 104
BstNI CCWGG 1 cut(s) 29
BstSCI CCNGG 1 cut(s) 27
BstV1I GCAGC 1 cut(s) 85
BsuRI GGCC 1 cut(s) 62
BtsCI GGATG 1 cut(s) 24
BtsIMutI CAGTG 1 cut(s) 157
CfoI GCGC 1 cut(s) 7
Cfr13I GGNCC 3 cut(s) 31, 60, 76
CviJI RGCY 3 cut(s) 62, 71, 98
CviKI_1 RGCY 3 cut(s) 62, 71, 98
DdeI CTNAG 1 cut(s) 12
DpnI GATC 2 cut(s) 135, 149
DpnII GATC 2 cut(s) 133, 147
Eam1104I CTCTTC 1 cut(s) 159
EarI CTCTTC 1 cut(s) 159
Eco47I GGWCC 2 cut(s) 31, 76
EcoO109I RGGNCCY 1 cut(s) 60
EcoRII CCWGG 1 cut(s) 27
FaiI YATR 1 cut(s) 172
FalI AAGNNNNNCTT 2 cut(s) 87, 119
FbaI TGATCA 1 cut(s) 147
Fnu4HI GCNGC 1 cut(s) 99
FokI GGATG 1 cut(s) 11
Fsp4HI GCNGC 1 cut(s) 99
FspBI CTAG 1 cut(s) 108
GlaI GCGC 1 cut(s) 6
GluI GCNGC 1 cut(s) 99
HaeIII GGCC 1 cut(s) 62
HhaI GCGC 1 cut(s) 7
Hin6I GCGC 1 cut(s) 5
HinP1I GCGC 1 cut(s) 5
HinfI GANTC 3 cut(s) 16, 43, 119
Hpy166II GTNNAC 1 cut(s) 155
Hpy188I TCNGA 1 cut(s) 67
Hpy188III TCNNGA 1 cut(s) 123
Hpy8I GTNNAC 1 cut(s) 155
HpyCH4IV ACGT 1 cut(s) 38
HpyF10VI GCNNNNNNNGC 2 cut(s) 68, 104
HpyF3I CTNAG 1 cut(s) 12
HpySE526I ACGT 1 cut(s) 38
HspAI GCGC 1 cut(s) 5
Ksp22I TGATCA 1 cut(s) 147
Kzo9I GATC 2 cut(s) 133, 147
LpnPI CCDG 7 cut(s) 14, 24, 33, 41, 47, 68, 108
Lsp1109I GCAGC 1 cut(s) 85
MaeI CTAG 1 cut(s) 108
MaeII ACGT 1 cut(s) 38
MaeIII GTNAC 1 cut(s) 110
MalI GATC 2 cut(s) 135, 149
MboI GATC 2 cut(s) 133, 147
MboII GAAGA 1 cut(s) 176
MnlI CCTC 4 cut(s) 51, 67, 73, 160
MseI TTAA 2 cut(s) 83, 197
MspR9I CCNGG 1 cut(s) 29
MvaI CCWGG 1 cut(s) 29
MwoI GCNNNNNNNGC 2 cut(s) 68, 104
NdeII GATC 2 cut(s) 133, 147
NmeAIII GCCGAG 1 cut(s) 97
PfeI GAWTC 3 cut(s) 16, 43, 119
PfoI TCCNGGA 1 cut(s) 27
PkrI GCNGC 1 cut(s) 100
Psp6I CCWGG 1 cut(s) 27
PspGI CCWGG 1 cut(s) 27
PspPI GGNCC 3 cut(s) 31, 60, 76
SaqAI TTAA 2 cut(s) 83, 197
SatI GCNGC 1 cut(s) 99
Sau3AI GATC 2 cut(s) 133, 147
Sau96I GGNCC 3 cut(s) 31, 60, 76
ScrFI CCNGG 1 cut(s) 29
SetI ASST 4 cut(s) 13, 41, 100, 171
SinI GGWCC 2 cut(s) 31, 76
SsiI CCGC 1 cut(s) 79
SspMI CTAG 1 cut(s) 108
StyD4I CCNGG 1 cut(s) 27
TaiI ACGT 1 cut(s) 41
TfiI GAWTC 3 cut(s) 16, 43, 119
Tru1I TTAA 2 cut(s) 83, 197
Tru9I TTAA 2 cut(s) 83, 197
TscAI CASTG 1 cut(s) 157
TseI GCWGC 1 cut(s) 98
TspRI CASTG 1 cut(s) 157
VpaK11BI GGWCC 2 cut(s) 31, 76
XspI CTAG 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.