Rh4AG098400

Belongs to the TPP enzyme family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
21206826 .. 21207167
342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG098400.1

Sequence Viewer

Length: 213 bp
ATGGCACAGGGTTTGTCTACTATGCTACAATGTGGGCGGAGAAATATCATATTTCTTCTTAACAATGGTGGATATCCAAAAGAAGAAAAGTTCCATCTTGGGCTGTACAATGTAATAATGAACTGGAACTACACTACCTTGGTTGATTCTTCTATCCGTAATGGGGAGAGCAACTGCTGGACAACCAAGTTCAATGCGAGGAGGAGCTTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

8.09

Weight (kDa)

9.51

Isoelectric Point (pI)

55.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 17
AciI CCGC 1 cut(s) 37
AfaI GTAC 1 cut(s) 107
AfiI CCNNNNNNNGG 1 cut(s) 163
AgsI TTSAA 1 cut(s) 193
AluBI AGCT 1 cut(s) 207
AluI AGCT 1 cut(s) 207
BccI CCATC 1 cut(s) 102
BsaJI CCNNGG 1 cut(s) 138
Bsc4I CCNNNNNNNGG 1 cut(s) 163
Bse1I ACTGG 1 cut(s) 128
BseDI CCNNGG 1 cut(s) 138
BseLI CCNNNNNNNGG 1 cut(s) 163
BseNI ACTGG 1 cut(s) 128
BslI CCNNNNNNNGG 1 cut(s) 163
Bsp1407I TGTACA 1 cut(s) 105
BspACI CCGC 1 cut(s) 37
BsrGI TGTACA 1 cut(s) 105
BsrI ACTGG 1 cut(s) 128
BssECI CCNNGG 1 cut(s) 138
BssT1I CCWWGG 1 cut(s) 138
BstAUI TGTACA 1 cut(s) 105
Csp6I GTAC 1 cut(s) 106
CviJI RGCY 2 cut(s) 103, 207
CviKI_1 RGCY 2 cut(s) 103, 207
CviQI GTAC 1 cut(s) 106
EciI GGCGGA 1 cut(s) 52
Eco130I CCWWGG 1 cut(s) 138
Eco32I GATATC 1 cut(s) 74
EcoRV GATATC 1 cut(s) 74
EcoT14I CCWWGG 1 cut(s) 138
ErhI CCWWGG 1 cut(s) 138
FaiI YATR 3 cut(s) 23, 50, 211
FblI GTMKAC 1 cut(s) 17
HinfI GANTC 1 cut(s) 146
Hpy166II GTNNAC 1 cut(s) 18
Hpy8I GTNNAC 1 cut(s) 18
LmnI GCTCC 1 cut(s) 204
LpnPI CCDG 2 cut(s) 109, 163
MboII GAAGA 3 cut(s) 47, 95, 141
MnlI CCTC 2 cut(s) 192, 195
MseI TTAA 1 cut(s) 60
PfeI GAWTC 1 cut(s) 146
PsrI GAACNNNNNNTAC 2 cut(s) 113, 145
RsaI GTAC 1 cut(s) 107
RsaNI GTAC 1 cut(s) 106
SaqAI TTAA 1 cut(s) 60
SetI ASST 2 cut(s) 140, 209
SgeI CNNG 6 cut(s) 20, 110, 136, 151, 190, 199
SsiI CCGC 1 cut(s) 37
StyI CCWWGG 1 cut(s) 138
TatI WGTACW 1 cut(s) 105
TfiI GAWTC 1 cut(s) 146
Tru1I TTAA 1 cut(s) 60
Tru9I TTAA 1 cut(s) 60
TspDTI ATGAA 1 cut(s) 134
TspGWI ACGGA 1 cut(s) 146
XmiI GTMKAC 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.