Rh4DG049800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0008854
Physical Location & Seq
Reverse (-)
7999649 .. 8000989
1341 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG049800.1

Sequence Viewer

Length: 360 bp
ATGGCTTCGACCTATTCTTCCTCCACCTCAACCCCTCCGATCTCGGCCTCGAACAACGCCTCACCGACGGTCGTCCCATCAACTTTAACACTCAATTCGCCGACGACCACATTACACTTCACATCATTCTCTACAACAGAAATCCACATTATGTTTAGAACTTGTAAATTTTGCATCTATGCTAGCACAGCAGTAGCAATTCTAATCATAAGAATCAAAATTTCCGCAAATTCAACAAAATCCAGAAGCAAATCAAAGCCAACTGACCTTATCAAATCTCAAGAACACCACCAAGAGGACCATGGCTTAGTTGGACCGGAAATGGGTCAAATTCTAGAAGAGCCAGGTCGTGGCGTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

119

Amino Acids

12.82

Weight (kDa)

8.69

Isoelectric Point (pI)

50.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 350
AciI CCGC 1 cut(s) 225
AcsI RAATTY 4 cut(s) 167, 219, 229, 330
AcyI GRCGYC 1 cut(s) 354
AfiI CCNNNNNNNGG 3 cut(s) 295, 323, 350
AgsI TTSAA 1 cut(s) 234
AjnI CCWGG 1 cut(s) 343
AoxI GGCC 1 cut(s) 45
ApoI RAATTY 4 cut(s) 167, 219, 229, 330
AspS9I GGNCC 2 cut(s) 298, 314
AsuHPI GGTGA 1 cut(s) 54
AsuNHI GCTAGC 1 cut(s) 182
AvaII GGWCC 2 cut(s) 298, 314
BccI CCATC 1 cut(s) 85
BciT130I CCWGG 1 cut(s) 345
BfaI CTAG 2 cut(s) 183, 335
Bme1390I CCNGG 1 cut(s) 345
Bme18I GGWCC 2 cut(s) 298, 314
BmgT120I GGNCC 2 cut(s) 298, 314
BmrFI CCNGG 1 cut(s) 345
BmsI GCATC 1 cut(s) 183
BmtI GCTAGC 1 cut(s) 186
BoxI GACNNNNGTC 1 cut(s) 71
BpuEI CTTGAG 1 cut(s) 264
BsaHI GRCGYC 1 cut(s) 354
BsaJI CCNNGG 1 cut(s) 301
BsaWI WCCGGW 1 cut(s) 316
Bsc4I CCNNNNNNNGG 3 cut(s) 295, 323, 350
BseBI CCWGG 1 cut(s) 345
BseDI CCNNGG 1 cut(s) 301
BseLI CCNNNNNNNGG 3 cut(s) 295, 323, 350
Bsh1285I CGRYCG 1 cut(s) 72
BshFI GGCC 1 cut(s) 47
BsiEI CGRYCG 1 cut(s) 72
BsiSI CCGG 1 cut(s) 317
BslFI GGGAC 1 cut(s) 59
BslI CCNNNNNNNGG 3 cut(s) 295, 323, 350
BsmFI GGGAC 1 cut(s) 59
BsnI GGCC 1 cut(s) 47
Bsp143I GATC 1 cut(s) 39
Bsp19I CCATGG 1 cut(s) 301
BspACI CCGC 1 cut(s) 225
BspANI GGCC 1 cut(s) 47
BspOI GCTAGC 1 cut(s) 186
BspQI GCTCTTC 1 cut(s) 333
BssECI CCNNGG 1 cut(s) 301
BssMI GATC 1 cut(s) 39
BssNI GRCGYC 1 cut(s) 354
BssT1I CCWWGG 1 cut(s) 301
Bst2UI CCWGG 1 cut(s) 345
Bst4CI ACNGT 1 cut(s) 70
Bst6I CTCTTC 1 cut(s) 333
BstACI GRCGYC 1 cut(s) 354
BstC8I GCNNGC 1 cut(s) 184
BstDEI CTNAG 1 cut(s) 307
BstDSI CCRYGG 1 cut(s) 301
BstKTI GATC 1 cut(s) 42
BstMBI GATC 1 cut(s) 39
BstMCI CGRYCG 1 cut(s) 72
BstMWI GCNNNNNNNGC 1 cut(s) 188
BstNI CCWGG 1 cut(s) 345
BstPAI GACNNNNGTC 1 cut(s) 71
BstSCI CCNGG 1 cut(s) 343
BsuRI GGCC 1 cut(s) 47
BtgI CCRYGG 1 cut(s) 301
Cac8I GCNNGC 1 cut(s) 184
Cfr13I GGNCC 2 cut(s) 298, 314
CseI GACGC 1 cut(s) 343
CviAII CATG 1 cut(s) 302
CviJI RGCY 5 cut(s) 5, 47, 259, 306, 343
CviKI_1 RGCY 5 cut(s) 5, 47, 259, 306, 343
DdeI CTNAG 1 cut(s) 307
DpnI GATC 1 cut(s) 41
DpnII GATC 1 cut(s) 39
Eam1104I CTCTTC 1 cut(s) 333
EarI CTCTTC 1 cut(s) 333
Eco130I CCWWGG 1 cut(s) 301
Eco47I GGWCC 2 cut(s) 298, 314
EcoRII CCWGG 1 cut(s) 343
EcoT14I CCWWGG 1 cut(s) 301
ErhI CCWWGG 1 cut(s) 301
FaeI CATG 1 cut(s) 305
FaiI YATR 4 cut(s) 152, 180, 209, 303
FaqI GGGAC 1 cut(s) 59
FatI CATG 1 cut(s) 301
FspBI CTAG 2 cut(s) 183, 335
HaeIII GGCC 1 cut(s) 47
HapII CCGG 1 cut(s) 317
HgaI GACGC 1 cut(s) 343
Hin1I GRCGYC 1 cut(s) 354
Hin1II CATG 1 cut(s) 305
HinfI GANTC 1 cut(s) 213
HpaII CCGG 1 cut(s) 317
HphI GGTGA 1 cut(s) 54
Hpy188I TCNGA 2 cut(s) 39, 359
Hpy188III TCNNGA 3 cut(s) 243, 281, 335
Hpy99I CGWCG 2 cut(s) 70, 106
HpyCH4III ACNGT 1 cut(s) 70
HpyCH4V TGCA 1 cut(s) 174
HpyF10VI GCNNNNNNNGC 1 cut(s) 188
HpyF3I CTNAG 1 cut(s) 307
Hsp92I GRCGYC 1 cut(s) 354
Hsp92II CATG 1 cut(s) 305
Kzo9I GATC 1 cut(s) 39
LguI GCTCTTC 1 cut(s) 333
LpnPI CCDG 3 cut(s) 256, 330, 330
LweI GCATC 1 cut(s) 183
MaeI CTAG 2 cut(s) 183, 335
MalI GATC 1 cut(s) 41
MboI GATC 1 cut(s) 39
MboII GAAGA 2 cut(s) 9, 350
MluCI AATT 6 cut(s) 94, 167, 198, 219, 229, 330
MmeI TCCRAC 1 cut(s) 292
MnlI CCTC 6 cut(s) 31, 37, 45, 58, 70, 289
MseI TTAA 1 cut(s) 86
MspI CCGG 1 cut(s) 317
MspR9I CCNGG 1 cut(s) 345
MvaI CCWGG 1 cut(s) 345
MwoI GCNNNNNNNGC 1 cut(s) 188
NcoI CCATGG 1 cut(s) 301
NdeII GATC 1 cut(s) 39
NheI GCTAGC 1 cut(s) 182
NlaIII CATG 1 cut(s) 305
NmeAIII GCCGAG 1 cut(s) 23
PciSI GCTCTTC 1 cut(s) 333
PfeI GAWTC 1 cut(s) 213
PflMI CCANNNNNTGG 1 cut(s) 350
PshAI GACNNNNGTC 1 cut(s) 71
Psp6I CCWGG 1 cut(s) 343
PspGI CCWGG 1 cut(s) 343
PspPI GGNCC 2 cut(s) 298, 314
SapI GCTCTTC 1 cut(s) 333
SaqAI TTAA 1 cut(s) 86
Sau3AI GATC 1 cut(s) 39
Sau96I GGNCC 2 cut(s) 298, 314
ScrFI CCNGG 1 cut(s) 345
SetI ASST 4 cut(s) 14, 29, 270, 349
SfaNI GCATC 1 cut(s) 183
SinI GGWCC 2 cut(s) 298, 314
SmlI CTYRAG 1 cut(s) 279
SmoI CTYRAG 1 cut(s) 279
Sse9I AATT 6 cut(s) 94, 167, 198, 219, 229, 330
SsiI CCGC 1 cut(s) 225
SspMI CTAG 2 cut(s) 183, 335
StyD4I CCNGG 1 cut(s) 343
StyI CCWWGG 1 cut(s) 301
TaaI ACNGT 1 cut(s) 70
TaqI TCGA 2 cut(s) 8, 50
TasI AATT 6 cut(s) 94, 167, 198, 219, 229, 330
TfiI GAWTC 1 cut(s) 213
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
Van91I CCANNNNNTGG 1 cut(s) 350
VpaK11BI GGWCC 2 cut(s) 298, 314
XapI RAATTY 4 cut(s) 167, 219, 229, 330
XbaI TCTAGA 1 cut(s) 334
XcmI CCANNNNNNNNNTGG 2 cut(s) 299, 308
XspI CTAG 2 cut(s) 183, 335
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.