Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr5A

Orthogroup ID

OG0008852

Physical Location & Seq

Genomic Coordinates Reverse (-)

18719922 .. 18720315

Gene Structure 394 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh5AG169200.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 294 bp

ATGGTTCATAAGGCCTGTACTATTTACGTGATTCCCTTGATCCTGTTGCTATTCTTCTTCTCATCCAACGTCGTTTCTGCTGGAATTTCTTACATTCCAATAACCAAAGAGAAAAGGAATCACCATGTGAATATGGATATTATTAAAGGAAGGAAAATAGGCGTACCAGTACCTTCTACACCTGGAGATAGCCATGGTAATTGTGAAACTAGCTTCGGTTCTAGAATATTGATCATCTATTTACCTAGCTACTTCAAGTTTTACAAGTTTGTTAACGCATATGCTCACTTTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

97

Amino Acids

10.98

Weight (kDa)

9.55

Isoelectric Point (pI)

42.68

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008852)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g14400 FvH4_3g14410 FvH4_3g20150
malus_domestica	MD05G1237600.v1.1 MD05G1237700.v1.1 MD10G1213200.v1.1 MD10G1214100.v1.1 MD10G1214900.v1.1 MD17G1153000.v1.1
prunus_persica	Prupe.2G064800_v2.0.a1 Prupe.4G128900_v2.0.a1 Prupe.4G129100_v2.0.a1
rosa_multiflora	Rmu_sc0004593.1_g000021
rosa_roxburghii	Rroxscaffold_1G00046260 Rroxscaffold_1G00055540
rosa_rugosa	Rorug05G0079300
rosa_samantha	Rh1AG336000 Rh1BG297400 Rh5AG169200 Rh5AG234700 Rh5BG166000 Rh5BG166600
rosa_wichuraiana	Rw0G001590

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	34
AcsI	RAATTY	1 cut(s)	84
AdeI	CACNNNGTG	1 cut(s)	127
AfaI	GTAC	3 cut(s)	19, 165, 171
AgsI	TTSAA	1 cut(s)	256
AjnI	CCWGG	1 cut(s)	181
AluBI	AGCT	2 cut(s)	213, 249
AluI	AGCT	2 cut(s)	213, 249
AlwI	GGATC	1 cut(s)	34
AoxI	GGCC	1 cut(s)	12
ApoI	RAATTY	1 cut(s)	84
AsuHPI	GGTGA	1 cut(s)	113
BciT130I	CCWGG	1 cut(s)	183
BclI	TGATCA	1 cut(s)	231
BfaI	CTAG	3 cut(s)	210, 222, 246
Bme1390I	CCNGG	1 cut(s)	183
BmrFI	CCNGG	1 cut(s)	183
BpmI	CTGGAG	1 cut(s)	204
BsaAI	YACGTR	1 cut(s)	28
BsaJI	CCNNGG	1 cut(s)	193
Bse1I	ACTGG	1 cut(s)	167
BseBI	CCWGG	1 cut(s)	183
BseDI	CCNNGG	1 cut(s)	193
BseGI	GGATG	1 cut(s)	62
BseNI	ACTGG	1 cut(s)	167
BshFI	GGCC	1 cut(s)	14
BsnI	GGCC	1 cut(s)	14
Bsp143I	GATC	2 cut(s)	39, 231
Bsp19I	CCATGG	1 cut(s)	193
BspANI	GGCC	1 cut(s)	14
BspPI	GGATC	1 cut(s)	34
BsrI	ACTGG	1 cut(s)	167
BssECI	CCNNGG	1 cut(s)	193
BssMI	GATC	2 cut(s)	39, 231
BssT1I	CCWWGG	1 cut(s)	193
Bst2UI	CCWGG	1 cut(s)	183
BstBAI	YACGTR	1 cut(s)	28
BstDSI	CCRYGG	1 cut(s)	193
BstF5I	GGATG	1 cut(s)	62
BstKTI	GATC	2 cut(s)	42, 234
BstMBI	GATC	2 cut(s)	39, 231
BstNI	CCWGG	1 cut(s)	183
BstSCI	CCNGG	1 cut(s)	181
BsuRI	GGCC	1 cut(s)	14
BtgI	CCRYGG	1 cut(s)	193
BtsCI	GGATG	1 cut(s)	62
Csp6I	GTAC	3 cut(s)	18, 164, 170
CviAII	CATG	2 cut(s)	125, 194
CviJI	RGCY	4 cut(s)	14, 192, 213, 249
CviKI_1	RGCY	4 cut(s)	14, 192, 213, 249
CviQI	GTAC	3 cut(s)	18, 164, 170
DpnI	GATC	2 cut(s)	41, 233
DpnII	GATC	2 cut(s)	39, 231
DraIII	CACNNNGTG	1 cut(s)	127
Eco130I	CCWWGG	1 cut(s)	193
Eco147I	AGGCCT	1 cut(s)	14
EcoRII	CCWGG	1 cut(s)	181
EcoT14I	CCWWGG	1 cut(s)	193
ErhI	CCWWGG	1 cut(s)	193
FaeI	CATG	2 cut(s)	128, 197
FaiI	YATR	6 cut(s)	9, 126, 134, 195, 280, 282
FatI	CATG	2 cut(s)	124, 193
FauNDI	CATATG	1 cut(s)	280
FbaI	TGATCA	1 cut(s)	231
FokI	GGATG	1 cut(s)	49
FspBI	CTAG	3 cut(s)	210, 222, 246
GsuI	CTGGAG	1 cut(s)	204
HaeIII	GGCC	1 cut(s)	14
Hin1II	CATG	2 cut(s)	128, 197
HincII	GTYRAC	1 cut(s)	274
HindII	GTYRAC	1 cut(s)	274
HinfI	GANTC	2 cut(s)	31, 118
HpaI	GTTAAC	1 cut(s)	274
HphI	GGTGA	1 cut(s)	113
Hpy166II	GTNNAC	1 cut(s)	274
Hpy188III	TCNNGA	1 cut(s)	222
Hpy8I	GTNNAC	1 cut(s)	274
Hpy99I	CGWCG	1 cut(s)	74
HpyAV	CCTTC	2 cut(s)	144, 183
HpyCH4IV	ACGT	2 cut(s)	27, 69
HpySE526I	ACGT	2 cut(s)	27, 69
Hsp92II	CATG	2 cut(s)	128, 197
Ksp22I	TGATCA	1 cut(s)	231
KspAI	GTTAAC	1 cut(s)	274
Kzo9I	GATC	2 cut(s)	39, 231
LpnPI	CCDG	6 cut(s)	28, 56, 66, 168, 180, 195
MaeI	CTAG	3 cut(s)	210, 222, 246
MaeII	ACGT	2 cut(s)	27, 69
MalI	GATC	2 cut(s)	41, 233
MboI	GATC	2 cut(s)	39, 231
MboII	GAAGA	2 cut(s)	46, 49
MluCI	AATT	2 cut(s)	84, 199
MmeI	TCCRAC	1 cut(s)	90
MseI	TTAA	2 cut(s)	144, 273
MspR9I	CCNGG	1 cut(s)	183
MvaI	CCWGG	1 cut(s)	183
NcoI	CCATGG	1 cut(s)	193
NdeI	CATATG	1 cut(s)	280
NdeII	GATC	2 cut(s)	39, 231
NlaIII	CATG	2 cut(s)	128, 197
PceI	AGGCCT	1 cut(s)	14
PfeI	GAWTC	2 cut(s)	31, 118
Ppu21I	YACGTR	1 cut(s)	28
Psp6I	CCWGG	1 cut(s)	181
PspGI	CCWGG	1 cut(s)	181
RsaI	GTAC	3 cut(s)	19, 165, 171
RsaNI	GTAC	3 cut(s)	18, 164, 170
SaqAI	TTAA	2 cut(s)	144, 273
Sau3AI	GATC	2 cut(s)	39, 231
ScrFI	CCNGG	1 cut(s)	183
SetI	ASST	7 cut(s)	30, 72, 175, 184, 215, 247, 251
Sse9I	AATT	2 cut(s)	84, 199
SseBI	AGGCCT	1 cut(s)	14
SspI	AATATT	1 cut(s)	228
SspMI	CTAG	3 cut(s)	210, 222, 246
StuI	AGGCCT	1 cut(s)	14
StyD4I	CCNGG	1 cut(s)	181
StyI	CCWWGG	1 cut(s)	193
TaiI	ACGT	2 cut(s)	30, 72
TasI	AATT	2 cut(s)	84, 199
TatI	WGTACW	1 cut(s)	17
TfiI	GAWTC	2 cut(s)	31, 118
Tru1I	TTAA	2 cut(s)	144, 273
Tru9I	TTAA	2 cut(s)	144, 273
XapI	RAATTY	1 cut(s)	84
XbaI	TCTAGA	1 cut(s)	221
XspI	CTAG	3 cut(s)	210, 222, 246

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.