Rh5CG576600

Protein of unknown function, DUF538

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
81654152 .. 81659721
5570 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG576600.1

Sequence Viewer

Length: 216 bp
ATGACGGTCGATTTGCCGCCGTCCGATAGTATTTACTTCACCGTTGGGATCATCAACAAGAAGCTCGATGTCGATCAGTTCCAGAGCGTTCATTCTTGCCGCGACGGGCTTTCGGGTTCGGGTTCGGGTTCGGGTTCTTGCCTCGGGTCGTTGAAACGGGTCGTTCAGCTTCCATCTCCACTGGAAGAAGAGATAAAGATGCTACTTACTGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

7.61

Weight (kDa)

4.9

Isoelectric Point (pI)

65.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 102
AciI CCGC 2 cut(s) 17, 100
AclWI GGATC 1 cut(s) 56
AgsI TTSAA 1 cut(s) 154
AluBI AGCT 2 cut(s) 64, 169
AluI AGCT 2 cut(s) 64, 169
AlwI GGATC 1 cut(s) 56
Ama87I CYCGRG 1 cut(s) 143
ArsI GACNNNNNNTTYG 1 cut(s) 27
AsuHPI GGTGA 1 cut(s) 31
AvaI CYCGRG 1 cut(s) 143
BccI CCATC 1 cut(s) 181
BceAI ACGGC 1 cut(s) 4
BisI GCNGC 2 cut(s) 17, 100
BlsI GCNGC 2 cut(s) 18, 101
BmeT110I CYCGRG 1 cut(s) 143
BmsI GCATC 1 cut(s) 189
BsaBI GATNNNNATC 1 cut(s) 72
BsaJI CCNNGG 1 cut(s) 142
Bse1I ACTGG 1 cut(s) 186
Bse8I GATNNNNATC 1 cut(s) 72
BseDI CCNNGG 1 cut(s) 142
BseJI GATNNNNATC 1 cut(s) 72
BseMII CTCAG 1 cut(s) 201
BseNI ACTGG 1 cut(s) 186
Bsh1236I CGCG 1 cut(s) 102
Bsh1285I CGRYCG 1 cut(s) 9
BsiEI CGRYCG 1 cut(s) 9
BsiHKCI CYCGRG 1 cut(s) 143
BsoBI CYCGRG 1 cut(s) 143
Bsp143I GATC 2 cut(s) 48, 73
BspACI CCGC 2 cut(s) 17, 100
BspCNI CTCAG 1 cut(s) 202
BspFNI CGCG 1 cut(s) 102
BspPI GGATC 1 cut(s) 56
BsrI ACTGG 1 cut(s) 186
BssECI CCNNGG 1 cut(s) 142
BssMI GATC 2 cut(s) 48, 73
Bst4CI ACNGT 2 cut(s) 7, 43
Bst6I CTCTTC 1 cut(s) 183
BstDEI CTNAG 1 cut(s) 210
BstFNI CGCG 1 cut(s) 102
BstKTI GATC 2 cut(s) 51, 76
BstMBI GATC 2 cut(s) 48, 73
BstMCI CGRYCG 1 cut(s) 9
BstUI CGCG 1 cut(s) 102
BtsIMutI CAGTG 1 cut(s) 179
CviJI RGCY 3 cut(s) 64, 109, 169
CviKI_1 RGCY 3 cut(s) 64, 109, 169
DdeI CTNAG 1 cut(s) 210
DpnI GATC 2 cut(s) 50, 75
DpnII GATC 2 cut(s) 48, 73
Eam1104I CTCTTC 1 cut(s) 183
EarI CTCTTC 1 cut(s) 183
Eco88I CYCGRG 1 cut(s) 143
Fnu4HI GCNGC 2 cut(s) 17, 100
Fsp4HI GCNGC 2 cut(s) 17, 100
GluI GCNGC 2 cut(s) 17, 100
HphI GGTGA 1 cut(s) 31
Hpy188I TCNGA 1 cut(s) 25
Hpy188III TCNNGA 1 cut(s) 82
Hpy99I CGWCG 1 cut(s) 107
HpyCH4III ACNGT 2 cut(s) 7, 43
HpyF3I CTNAG 1 cut(s) 210
Kzo9I GATC 2 cut(s) 48, 73
LpnPI CCDG 2 cut(s) 95, 167
LweI GCATC 1 cut(s) 189
MalI GATC 2 cut(s) 50, 75
MboI GATC 2 cut(s) 48, 73
MboII GAAGA 2 cut(s) 197, 200
MnlI CCTC 1 cut(s) 152
MvnI CGCG 1 cut(s) 102
NdeII GATC 2 cut(s) 48, 73
PkrI GCNGC 2 cut(s) 18, 101
SatI GCNGC 2 cut(s) 17, 100
Sau3AI GATC 2 cut(s) 48, 73
SetI ASST 2 cut(s) 66, 171
SfaNI GCATC 1 cut(s) 189
SsiI CCGC 2 cut(s) 17, 100
TaaI ACNGT 2 cut(s) 7, 43
TaqI TCGA 3 cut(s) 9, 66, 72
TauI GCSGC 2 cut(s) 19, 102
TscAI CASTG 1 cut(s) 186
TspDTI ATGAA 1 cut(s) 80
TspRI CASTG 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.