Rh6BG023400

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0006969
Physical Location & Seq
Reverse (-)
3438603 .. 3438971
369 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG023400.1

Sequence Viewer

Length: 369 bp
ATGGGGAGGAGAGTTGGAAATATTTTAGGAAAATTGGTGGACGTTGACCCTGGGGTGAATGGAGACTGCTCTGGGAGCTTTCTCTTAATCCGAGTGGGGTTGGATGTCAACATGCCTCTAAGAAGATGGATTAGGCTTCAACTTGAGAATTCAGGAGAGGAAGTCAAACTCTTACTGGATTACGAGAACCTTCCCTACTTTTGTTTCTATTGTGGTTGTTTGGATCATGTTAGCTCTTGCTATGAACTGAAAAAGGCGGGGAAAATACAGGAAGTGCAATATGGTAGGTGGAAGACCCTTTCAAAGAATGTGTTTAACATTGATCTTCATGCATGGTCAATTACAAGGTGTCATATTTGGTCTTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1

Protein Analysis

122

Amino Acids

14.01

Weight (kDa)

8.23

Isoelectric Point (pI)

54.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-CCHC_4 PF14392 34 - 78 2.9e-08 Zinc knuckle
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 257
AclWI GGATC 1 cut(s) 231
AcsI RAATTY 1 cut(s) 148
AgsI TTSAA 2 cut(s) 140, 303
AjnI CCWGG 1 cut(s) 49
AluBI AGCT 2 cut(s) 78, 234
AluI AGCT 2 cut(s) 78, 234
Alw26I GTCTC 1 cut(s) 57
AlwI GGATC 1 cut(s) 231
ApoI RAATTY 1 cut(s) 148
AsuHPI GGTGA 1 cut(s) 67
BbsI GAAGAC 2 cut(s) 299, 354
BccI CCATC 1 cut(s) 120
BciT130I CCWGG 1 cut(s) 51
BcoDI GTCTC 1 cut(s) 57
Bme1390I CCNGG 1 cut(s) 51
BmrFI CCNGG 1 cut(s) 51
BpiI GAAGAC 2 cut(s) 299, 354
BpuEI CTTGAG 1 cut(s) 164
BsaJI CCNNGG 2 cut(s) 49, 50
BsaXI ACNNNNNCTCC 2 cut(s) 147, 177
Bse1I ACTGG 1 cut(s) 180
BseBI CCWGG 1 cut(s) 51
BseDI CCNNGG 2 cut(s) 49, 50
BseGI GGATG 1 cut(s) 109
BseNI ACTGG 1 cut(s) 180
BseRI GAGGAG 1 cut(s) 22
BsmAI GTCTC 1 cut(s) 57
Bsp143I GATC 2 cut(s) 223, 322
BspACI CCGC 1 cut(s) 257
BspPI GGATC 1 cut(s) 231
BsrI ACTGG 1 cut(s) 180
BssECI CCNNGG 2 cut(s) 49, 50
BssMI GATC 2 cut(s) 223, 322
Bst2UI CCWGG 1 cut(s) 51
BstDEI CTNAG 1 cut(s) 119
BstF5I GGATG 1 cut(s) 109
BstKTI GATC 2 cut(s) 226, 325
BstMAI GTCTC 1 cut(s) 57
BstMBI GATC 2 cut(s) 223, 322
BstMWI GCNNNNNNNGC 1 cut(s) 75
BstNI CCWGG 1 cut(s) 51
BstNSI RCATGY 1 cut(s) 115
BstSCI CCNGG 1 cut(s) 49
BstV2I GAAGAC 2 cut(s) 299, 354
BtsCI GGATG 1 cut(s) 109
CviAII CATG 4 cut(s) 112, 227, 329, 333
CviJI RGCY 3 cut(s) 78, 136, 234
CviKI_1 RGCY 3 cut(s) 78, 136, 234
DdeI CTNAG 1 cut(s) 119
DpnI GATC 2 cut(s) 225, 324
DpnII GATC 2 cut(s) 223, 322
EcoRI GAATTC 1 cut(s) 148
EcoRII CCWGG 1 cut(s) 49
EcoT22I ATGCAT 1 cut(s) 334
FaeI CATG 4 cut(s) 115, 230, 332, 336
FaiI YATR 8 cut(s) 113, 228, 243, 282, 330, 334, 354, 367
FatI CATG 4 cut(s) 111, 226, 328, 332
FauI CCCGC 1 cut(s) 250
FokI GGATG 1 cut(s) 116
Hin1II CATG 4 cut(s) 115, 230, 332, 336
HincII GTYRAC 2 cut(s) 46, 109
HindII GTYRAC 2 cut(s) 46, 109
HphI GGTGA 1 cut(s) 67
Hpy166II GTNNAC 3 cut(s) 40, 46, 109
Hpy188I TCNGA 1 cut(s) 92
Hpy188III TCNNGA 1 cut(s) 153
Hpy8I GTNNAC 3 cut(s) 40, 46, 109
HpyAV CCTTC 1 cut(s) 200
HpyCH4IV ACGT 1 cut(s) 42
HpyCH4V TGCA 2 cut(s) 277, 332
HpyF10VI GCNNNNNNNGC 1 cut(s) 75
HpyF3I CTNAG 1 cut(s) 119
HpySE526I ACGT 1 cut(s) 42
Hsp92II CATG 4 cut(s) 115, 230, 332, 336
Kzo9I GATC 2 cut(s) 223, 322
LmnI GCTCC 1 cut(s) 75
LpnPI CCDG 6 cut(s) 36, 57, 63, 138, 161, 254
MaeII ACGT 1 cut(s) 42
MalI GATC 2 cut(s) 225, 324
MboI GATC 2 cut(s) 223, 322
MboII GAAGA 4 cut(s) 135, 304, 317, 354
MluCI AATT 3 cut(s) 32, 148, 339
MmeI TCCRAC 1 cut(s) 81
MnlI CCTC 2 cut(s) 126, 151
Mph1103I ATGCAT 1 cut(s) 334
MseI TTAA 2 cut(s) 86, 315
MspR9I CCNGG 1 cut(s) 51
MvaI CCWGG 1 cut(s) 51
MwoI GCNNNNNNNGC 1 cut(s) 75
NdeII GATC 2 cut(s) 223, 322
NlaIII CATG 4 cut(s) 115, 230, 332, 336
NsiI ATGCAT 1 cut(s) 334
NspI RCATGY 1 cut(s) 115
PasI CCCWGGG 1 cut(s) 50
Psp6I CCWGG 1 cut(s) 49
PspGI CCWGG 1 cut(s) 49
PsrI GAACNNNNNNTAC 2 cut(s) 179, 211
SaqAI TTAA 2 cut(s) 86, 315
Sau3AI GATC 2 cut(s) 223, 322
ScrFI CCNGG 1 cut(s) 51
SetI ASST 6 cut(s) 45, 80, 192, 236, 290, 350
SmlI CTYRAG 1 cut(s) 143
SmoI CTYRAG 1 cut(s) 143
Sse9I AATT 3 cut(s) 32, 148, 339
SsiI CCGC 1 cut(s) 257
SspI AATATT 1 cut(s) 22
StyD4I CCNGG 1 cut(s) 49
TaiI ACGT 1 cut(s) 45
TasI AATT 3 cut(s) 32, 148, 339
Tru1I TTAA 2 cut(s) 86, 315
Tru9I TTAA 2 cut(s) 86, 315
TspDTI ATGAA 3 cut(s) 258, 317, 354
XapI RAATTY 1 cut(s) 148
XceI RCATGY 1 cut(s) 115
Zsp2I ATGCAT 1 cut(s) 334
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.