Rh6BG252700

Ras-related protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
46403904 .. 46406484
2581 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG252700.1

Sequence Viewer

Length: 210 bp
ATGCAGCTATCTCAAGAATCGACAATTGTTGCTACCTTCTTCTCGCAAACATTGGCTGTAAATGACGCAACTGTAAAATTTGAGATTGGGGATACAACAGGTCAAGAGAGGTACCATAGTTTGGCGCCAATGTATTATAAGGGAGCTGTTGCTGCAATAATTGTGTATGATTTAACTAACCAAGTGAGTCCATTTATCCACATTCTTTAA

Protein Analysis

69

Amino Acids

7.66

Weight (kDa)

4.92

Isoelectric Point (pI)

44.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ras PF00071 4 - 63 7.5e-16 Ras family
Roc PF08477 4 - 60 4.5e-11 Ras of Complex, Roc, domain of DAPkinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 138
Acc65I GGTACC 1 cut(s) 111
AccB1I GGYRCC 2 cut(s) 111, 124
AccB7I CCANNNNNTGG 1 cut(s) 121
AcsI RAATTY 1 cut(s) 77
AcyI GRCGYC 1 cut(s) 125
AfaI GTAC 1 cut(s) 113
AfiI CCNNNNNNNGG 1 cut(s) 121
AluBI AGCT 2 cut(s) 7, 146
AluI AGCT 2 cut(s) 7, 146
ApeKI GCWGC 2 cut(s) 4, 152
ApoI RAATTY 1 cut(s) 77
Asp718I GGTACC 1 cut(s) 111
AspLEI GCGC 1 cut(s) 127
BaeI ACNNNNGTAYC 2 cut(s) 103, 136
BanI GGYRCC 2 cut(s) 111, 124
BbvI GCAGC 2 cut(s) 16, 139
BciVI GTATCC 1 cut(s) 85
BfoI RGCGCY 1 cut(s) 128
BfuI GTATCC 1 cut(s) 85
BisI GCNGC 2 cut(s) 5, 153
BlsI GCNGC 2 cut(s) 6, 154
BmiI GGNNCC 2 cut(s) 113, 126
BsaHI GRCGYC 1 cut(s) 125
Bsc4I CCNNNNNNNGG 1 cut(s) 121
BseLI CCNNNNNNNGG 1 cut(s) 121
BseXI GCAGC 2 cut(s) 16, 139
BshNI GGYRCC 2 cut(s) 111, 124
BslI CCNNNNNNNGG 1 cut(s) 121
BspLI GGNNCC 2 cut(s) 113, 126
BspT107I GGYRCC 2 cut(s) 111, 124
BssNI GRCGYC 1 cut(s) 125
Bst4CI ACNGT 1 cut(s) 73
BstACI GRCGYC 1 cut(s) 125
BstH2I RGCGCY 1 cut(s) 128
BstHHI GCGC 1 cut(s) 127
BstMWI GCNNNNNNNGC 1 cut(s) 152
BstV1I GCAGC 2 cut(s) 16, 139
BsuI GTATCC 1 cut(s) 85
CfoI GCGC 1 cut(s) 127
CseI GACGC 1 cut(s) 74
Csp6I GTAC 1 cut(s) 112
CviJI RGCY 3 cut(s) 7, 56, 146
CviKI_1 RGCY 3 cut(s) 7, 56, 146
CviQI GTAC 1 cut(s) 112
DinI GGCGCC 1 cut(s) 126
EgeI GGCGCC 1 cut(s) 126
EheI GGCGCC 1 cut(s) 126
FaiI YATR 3 cut(s) 117, 138, 168
Fnu4HI GCNGC 2 cut(s) 5, 153
Fsp4HI GCNGC 2 cut(s) 5, 153
GlaI GCGC 1 cut(s) 126
GluI GCNGC 2 cut(s) 5, 153
HaeII RGCGCY 1 cut(s) 128
HgaI GACGC 1 cut(s) 74
HhaI GCGC 1 cut(s) 127
Hin1I GRCGYC 1 cut(s) 125
Hin6I GCGC 1 cut(s) 125
HinP1I GCGC 1 cut(s) 125
HinfI GANTC 2 cut(s) 17, 187
Hpy188III TCNNGA 2 cut(s) 14, 104
HpyAV CCTTC 1 cut(s) 46
HpyCH4III ACNGT 1 cut(s) 73
HpyCH4V TGCA 2 cut(s) 4, 155
HpyF10VI GCNNNNNNNGC 1 cut(s) 152
Hsp92I GRCGYC 1 cut(s) 125
HspAI GCGC 1 cut(s) 125
KasI GGCGCC 1 cut(s) 124
KpnI GGTACC 1 cut(s) 115
LmnI GCTCC 1 cut(s) 143
LpnPI CCDG 1 cut(s) 84
Lsp1109I GCAGC 2 cut(s) 16, 139
MboII GAAGA 1 cut(s) 31
MfeI CAATTG 1 cut(s) 24
MluCI AATT 3 cut(s) 24, 77, 159
Mly113I GGCGCC 1 cut(s) 125
MlyI GAGTC 1 cut(s) 196
MnlI CCTC 1 cut(s) 102
MseI TTAA 2 cut(s) 173, 208
MunI CAATTG 1 cut(s) 24
MwoI GCNNNNNNNGC 1 cut(s) 152
NarI GGCGCC 1 cut(s) 125
NlaIV GGNNCC 2 cut(s) 113, 126
PfeI GAWTC 1 cut(s) 17
PflMI CCANNNNNTGG 1 cut(s) 121
PkrI GCNGC 2 cut(s) 6, 154
PleI GAGTC 1 cut(s) 195
PluTI GGCGCC 1 cut(s) 128
PpsI GAGTC 1 cut(s) 195
PsiI TTATAA 1 cut(s) 138
PspN4I GGNNCC 2 cut(s) 113, 126
RsaI GTAC 1 cut(s) 113
RsaNI GTAC 1 cut(s) 112
SaqAI TTAA 2 cut(s) 173, 208
SatI GCNGC 2 cut(s) 5, 153
SchI GAGTC 1 cut(s) 196
SetI ASST 5 cut(s) 9, 38, 103, 113, 148
SfoI GGCGCC 1 cut(s) 126
SgeI CNNG 5 cut(s) 26, 55, 111, 116, 194
SmlI CTYRAG 1 cut(s) 12
SmoI CTYRAG 1 cut(s) 12
Sse9I AATT 3 cut(s) 24, 77, 159
SspDI GGCGCC 1 cut(s) 124
TaaI ACNGT 1 cut(s) 73
TaqI TCGA 1 cut(s) 20
TasI AATT 3 cut(s) 24, 77, 159
TfiI GAWTC 1 cut(s) 17
Tru1I TTAA 2 cut(s) 173, 208
Tru9I TTAA 2 cut(s) 173, 208
TseI GCWGC 2 cut(s) 4, 152
Van91I CCANNNNNTGG 1 cut(s) 121
XapI RAATTY 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.