Rh6CG135900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
17234960 .. 17241658
6699 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG135900.1

Sequence Viewer

Length: 702 bp
ATGGACCCTACTCTGGATTTCGAGGAAGAGGAAGATGAATATGACAAAGTGGCTTCGGGTGCTAAAGCTGTTGATGATGATCGTTTGTTTATGGACGATGTTACCAACCATGGCTCTTATTTGAACTCTTACAATGTATTGGTTGGTAAGGATTCGCGTGCGAATCACCTGGCTGCCAGGCACAGGCTGAAAGAAGATGATGCTGAAGCTCAGAACCCTAGTTCTACACCAGTGGCTTCTGCTGCACTAGTTAAGCAACAGTTTGCGAAATCACCTGAAGATGGCGGTCAGCCAAAGCCTATACTGATTCAACAAGTGAAGTTGATGAAGGTGGCAACACCAAGGCTTATCGATATAAAGGTTCCTGGAGGGGGAATAGAGCTAGAGGAAGAGTTTGGGAAAATGGGAGAGAGCCAGAAGCAGTTCCAGATGGGAACCATTGAGGCTTTGAGTTTGTCGGTGGTGTCGTCTGTGTCAATTTACAAAGTTGGAACTTTTCCCCTGCATATTTGCTTGCTCTTAGTAACAAATGTAGGTGGCACTGTGAGATGCTTCAAGGCTTTCCAAAGAGCAAAACATGAGCATGAGGCATTAAAGAGGCAGCTTGAAACTTATTTCCAGGAATCAAGTGAGGAGGAGAGGGAGCATGCTGTGAAATTGATGGAATACCAGAGTAAGAGTTTTCAAGACAACCAAACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

233

Amino Acids

26.03

Weight (kDa)

5.15

Isoelectric Point (pI)

43.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 157
AciI CCGC 1 cut(s) 285
AcuI CTGAAG 2 cut(s) 225, 297
AfiI CCNNNNNNNGG 4 cut(s) 13, 183, 281, 371
AgsI TTSAA 5 cut(s) 124, 311, 556, 608, 686
AhlI ACTAGT 1 cut(s) 247
AjnI CCWGG 4 cut(s) 168, 176, 364, 618
AluBI AGCT 4 cut(s) 68, 209, 382, 604
AluI AGCT 4 cut(s) 68, 209, 382, 604
ApeKI GCWGC 3 cut(s) 173, 242, 601
Asp700I GAANNNNTTC 1 cut(s) 422
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 2 cut(s) 158, 264
AvaII GGWCC 1 cut(s) 4
BbvI GCAGC 3 cut(s) 160, 229, 613
BccI CCATC 3 cut(s) 275, 424, 655
BciT130I CCWGG 4 cut(s) 170, 178, 366, 620
BcuI ACTAGT 1 cut(s) 247
BfaI CTAG 3 cut(s) 219, 248, 383
BisI GCNGC 3 cut(s) 174, 243, 602
BlsI GCNGC 3 cut(s) 175, 244, 603
Bme1390I CCNGG 4 cut(s) 170, 178, 366, 620
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 3 cut(s) 6, 363, 436
BmrFI CCNGG 4 cut(s) 170, 178, 366, 620
BmsI GCATC 2 cut(s) 190, 539
BpmI CTGGAG 1 cut(s) 387
Bsa29I ATCGAT 1 cut(s) 351
BsaBI GATNNNNATC 1 cut(s) 78
BsaJI CCNNGG 2 cut(s) 109, 341
Bsc4I CCNNNNNNNGG 4 cut(s) 13, 183, 281, 371
Bse1I ACTGG 1 cut(s) 230
Bse8I GATNNNNATC 1 cut(s) 78
BseBI CCWGG 4 cut(s) 170, 178, 366, 620
BseCI ATCGAT 1 cut(s) 351
BseDI CCNNGG 2 cut(s) 109, 341
BseJI GATNNNNATC 1 cut(s) 78
BseLI CCNNNNNNNGG 4 cut(s) 13, 183, 281, 371
BseMII CTCAG 1 cut(s) 224
BseNI ACTGG 1 cut(s) 230
BseRI GAGGAG 2 cut(s) 647, 650
BseXI GCAGC 3 cut(s) 160, 229, 613
BsgI GTGCAG 1 cut(s) 228
Bsh1236I CGCG 1 cut(s) 157
BshVI ATCGAT 1 cut(s) 351
BslI CCNNNNNNNGG 4 cut(s) 13, 183, 281, 371
Bsp143I GATC 1 cut(s) 79
Bsp19I CCATGG 1 cut(s) 109
BspACI CCGC 1 cut(s) 285
BspCNI CTCAG 1 cut(s) 223
BspDI ATCGAT 1 cut(s) 351
BspFNI CGCG 1 cut(s) 157
BspLI GGNNCC 3 cut(s) 6, 363, 436
BsrI ACTGG 1 cut(s) 230
BssECI CCNNGG 2 cut(s) 109, 341
BssMI GATC 1 cut(s) 79
BssT1I CCWWGG 2 cut(s) 109, 341
Bst2UI CCWGG 4 cut(s) 170, 178, 366, 620
Bst4CI ACNGT 2 cut(s) 261, 544
Bst6I CTCTTC 2 cut(s) 21, 384
BstC8I GCNNGC 3 cut(s) 159, 515, 648
BstDEI CTNAG 3 cut(s) 210, 520, 699
BstDSI CCRYGG 1 cut(s) 109
BstFNI CGCG 1 cut(s) 157
BstKTI GATC 1 cut(s) 82
BstMBI GATC 1 cut(s) 79
BstMWI GCNNNNNNNGC 2 cut(s) 59, 242
BstNI CCWGG 4 cut(s) 170, 178, 366, 620
BstNSI RCATGY 1 cut(s) 650
BstSCI CCNGG 4 cut(s) 168, 176, 364, 618
BstUI CGCG 1 cut(s) 157
BstV1I GCAGC 3 cut(s) 160, 229, 613
Bsu15I ATCGAT 1 cut(s) 351
BsuTUI ATCGAT 1 cut(s) 351
BtgI CCRYGG 1 cut(s) 109
BtsIMutI CAGTG 2 cut(s) 237, 540
Cac8I GCNNGC 3 cut(s) 159, 515, 648
Cfr13I GGNCC 1 cut(s) 4
ClaI ATCGAT 1 cut(s) 351
CviAII CATG 4 cut(s) 110, 578, 584, 647
DdeI CTNAG 3 cut(s) 210, 520, 699
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
Eam1104I CTCTTC 2 cut(s) 21, 384
EarI CTCTTC 2 cut(s) 21, 384
Eco130I CCWWGG 2 cut(s) 109, 341
Eco47I GGWCC 1 cut(s) 4
Eco57I CTGAAG 2 cut(s) 225, 297
EcoRII CCWGG 4 cut(s) 168, 176, 364, 618
EcoT14I CCWWGG 2 cut(s) 109, 341
ErhI CCWWGG 2 cut(s) 109, 341
FaeI CATG 4 cut(s) 113, 581, 587, 650
FaiI YATR 9 cut(s) 42, 92, 111, 302, 356, 507, 579, 585, 648
FatI CATG 4 cut(s) 109, 577, 583, 646
Fnu4HI GCNGC 3 cut(s) 174, 243, 602
Fsp4HI GCNGC 3 cut(s) 174, 243, 602
FspBI CTAG 3 cut(s) 219, 248, 383
GluI GCNGC 3 cut(s) 174, 243, 602
GsuI CTGGAG 1 cut(s) 387
Hin1II CATG 4 cut(s) 113, 581, 587, 650
HinfI GANTC 4 cut(s) 152, 163, 307, 623
HphI GGTGA 2 cut(s) 158, 264
Hpy188I TCNGA 1 cut(s) 213
Hpy188III TCNNGA 3 cut(s) 14, 427, 686
HpyAV CCTTC 1 cut(s) 322
HpyCH4III ACNGT 2 cut(s) 261, 544
HpyCH4V TGCA 2 cut(s) 245, 505
HpyF10VI GCNNNNNNNGC 2 cut(s) 59, 242
HpyF3I CTNAG 3 cut(s) 210, 520, 699
Hsp92II CATG 4 cut(s) 113, 581, 587, 650
Kzo9I GATC 1 cut(s) 79
LmnI GCTCC 1 cut(s) 643
Lsp1109I GCAGC 3 cut(s) 160, 229, 613
LweI GCATC 2 cut(s) 190, 539
MaeI CTAG 3 cut(s) 219, 248, 383
MaeIII GTNAC 2 cut(s) 100, 523
MalI GATC 1 cut(s) 81
MboI GATC 1 cut(s) 79
MboII GAAGA 5 cut(s) 38, 44, 206, 290, 401
MluCI AATT 2 cut(s) 477, 656
MmeI TCCRAC 1 cut(s) 469
MroXI GAANNNNTTC 1 cut(s) 422
MseI TTAA 2 cut(s) 252, 593
MslI CAYNNNNRTG 1 cut(s) 582
MspR9I CCNGG 4 cut(s) 170, 178, 366, 620
MvaI CCWGG 4 cut(s) 170, 178, 366, 620
MvnI CGCG 1 cut(s) 157
MwoI GCNNNNNNNGC 2 cut(s) 59, 242
NcoI CCATGG 1 cut(s) 109
NdeII GATC 1 cut(s) 79
NlaIII CATG 4 cut(s) 113, 581, 587, 650
NlaIV GGNNCC 3 cut(s) 6, 363, 436
NspI RCATGY 1 cut(s) 650
PaeI GCATGC 1 cut(s) 650
PcsI WCGNNNNNNNCGW 1 cut(s) 464
PdmI GAANNNNTTC 1 cut(s) 422
PfeI GAWTC 4 cut(s) 152, 163, 307, 623
PfoI TCCNGGA 2 cut(s) 364, 618
PkrI GCNGC 3 cut(s) 175, 244, 603
Psp6I CCWGG 4 cut(s) 168, 176, 364, 618
PspGI CCWGG 4 cut(s) 168, 176, 364, 618
PspN4I GGNNCC 3 cut(s) 6, 363, 436
PspPI GGNCC 1 cut(s) 4
RseI CAYNNNNRTG 1 cut(s) 582
SaqAI TTAA 2 cut(s) 252, 593
SatI GCNGC 3 cut(s) 174, 243, 602
Sau3AI GATC 1 cut(s) 79
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 4 cut(s) 170, 178, 366, 620
SetI ASST 9 cut(s) 70, 171, 211, 277, 333, 363, 384, 538, 606
SfaNI GCATC 2 cut(s) 190, 539
SinI GGWCC 1 cut(s) 4
SmiMI CAYNNNNRTG 1 cut(s) 582
SpeI ACTAGT 1 cut(s) 247
SphI GCATGC 1 cut(s) 650
Sse9I AATT 2 cut(s) 477, 656
SsiI CCGC 1 cut(s) 285
SspMI CTAG 3 cut(s) 219, 248, 383
StyD4I CCNGG 4 cut(s) 168, 176, 364, 618
StyI CCWWGG 2 cut(s) 109, 341
TaaI ACNGT 2 cut(s) 261, 544
TaqI TCGA 2 cut(s) 21, 351
TasI AATT 2 cut(s) 477, 656
TfiI GAWTC 4 cut(s) 152, 163, 307, 623
Tru1I TTAA 2 cut(s) 252, 593
Tru9I TTAA 2 cut(s) 252, 593
TscAI CASTG 2 cut(s) 237, 547
TseI GCWGC 3 cut(s) 173, 242, 601
TspDTI ATGAA 2 cut(s) 51, 341
TspRI CASTG 2 cut(s) 237, 547
VpaK11BI GGWCC 1 cut(s) 4
XceI RCATGY 1 cut(s) 650
XmnI GAANNNNTTC 1 cut(s) 422
XspI CTAG 3 cut(s) 219, 248, 383
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.