AT2G16953

attrn1,trn1

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
Physical Location & Seq
Forward (+)
7361336 .. 7362157
822 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G16953.1

Sequence Viewer

Length: 195 bp
AGTGCAAACATTACTAAAGGAAACCTTGATGTCACAACTAATGCTTGTGAGGCCATAGGAGAATTAGCGGTAAAGGGTGTCAATAACGCACTAGTTGAGAACAGTGCAATTACCCTCGGGAGACTAGCATTGATTCGACCAGACTTAGTTGCACCATACATGAAGCCATGGTCCATGGCATTGTCAATGAAATAA

Protein Analysis

64

Amino Acids

6.76

Weight (kDa)

7.87

Isoelectric Point (pI)

26.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 68
AhlI ACTAGT 1 cut(s) 91
Alw26I GTCTC 1 cut(s) 115
Ama87I CYCGRG 1 cut(s) 116
AoxI GGCC 1 cut(s) 51
AspS9I GGNCC 1 cut(s) 171
AvaI CYCGRG 1 cut(s) 116
AvaII GGWCC 1 cut(s) 171
BcoDI GTCTC 1 cut(s) 115
BcuI ACTAGT 1 cut(s) 91
BfaI CTAG 2 cut(s) 92, 125
Bme18I GGWCC 1 cut(s) 171
BmeT110I CYCGRG 1 cut(s) 116
BmgT120I GGNCC 1 cut(s) 171
BsaJI CCNNGG 3 cut(s) 115, 167, 174
BseDI CCNNGG 3 cut(s) 115, 167, 174
BshFI GGCC 1 cut(s) 53
BsiHKCI CYCGRG 1 cut(s) 116
BsmAI GTCTC 1 cut(s) 115
BsnI GGCC 1 cut(s) 53
BsoBI CYCGRG 1 cut(s) 116
Bsp19I CCATGG 2 cut(s) 167, 174
BspACI CCGC 1 cut(s) 68
BspANI GGCC 1 cut(s) 53
BssECI CCNNGG 3 cut(s) 115, 167, 174
BssT1I CCWWGG 2 cut(s) 167, 174
Bst4CI ACNGT 1 cut(s) 104
BstDEI CTNAG 1 cut(s) 145
BstDSI CCRYGG 2 cut(s) 167, 174
BstMAI GTCTC 1 cut(s) 115
BstMWI GCNNNNNNNGC 1 cut(s) 50
BsuRI GGCC 1 cut(s) 53
BtgI CCRYGG 2 cut(s) 167, 174
BtsIMutI CAGTG 1 cut(s) 109
Cfr13I GGNCC 1 cut(s) 171
CviAII CATG 3 cut(s) 160, 168, 175
CviJI RGCY 2 cut(s) 53, 166
CviKI_1 RGCY 2 cut(s) 53, 166
DdeI CTNAG 1 cut(s) 145
Eco130I CCWWGG 2 cut(s) 167, 174
Eco47I GGWCC 1 cut(s) 171
Eco88I CYCGRG 1 cut(s) 116
EcoT14I CCWWGG 2 cut(s) 167, 174
ErhI CCWWGG 2 cut(s) 167, 174
FaeI CATG 3 cut(s) 163, 171, 178
FaiI YATR 5 cut(s) 56, 157, 161, 169, 176
FalI AAGNNNNNCTT 2 cut(s) 9, 41
FatI CATG 3 cut(s) 159, 167, 174
FspBI CTAG 2 cut(s) 92, 125
HaeIII GGCC 1 cut(s) 53
Hin1II CATG 3 cut(s) 163, 171, 178
HinfI GANTC 1 cut(s) 133
Hpy188III TCNNGA 1 cut(s) 118
HpyCH4III ACNGT 1 cut(s) 104
HpyCH4V TGCA 3 cut(s) 5, 107, 152
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
HpyF3I CTNAG 1 cut(s) 145
Hsp92II CATG 3 cut(s) 163, 171, 178
LpnPI CCDG 1 cut(s) 153
MaeI CTAG 2 cut(s) 92, 125
MaeIII GTNAC 1 cut(s) 31
MluCI AATT 2 cut(s) 62, 108
MnlI CCTC 2 cut(s) 43, 125
MwoI GCNNNNNNNGC 1 cut(s) 50
NcoI CCATGG 2 cut(s) 167, 174
NlaIII CATG 3 cut(s) 163, 171, 178
NmuCI GTSAC 1 cut(s) 31
PfeI GAWTC 1 cut(s) 133
PspPI GGNCC 1 cut(s) 171
Sau96I GGNCC 1 cut(s) 171
SetI ASST 1 cut(s) 27
SinI GGWCC 1 cut(s) 171
SpeI ACTAGT 1 cut(s) 91
Sse9I AATT 2 cut(s) 62, 108
SsiI CCGC 1 cut(s) 68
SspMI CTAG 2 cut(s) 92, 125
StyI CCWWGG 2 cut(s) 167, 174
TaaI ACNGT 1 cut(s) 104
TaqI TCGA 1 cut(s) 136
TasI AATT 2 cut(s) 62, 108
TfiI GAWTC 1 cut(s) 133
TscAI CASTG 1 cut(s) 109
TseFI GTSAC 1 cut(s) 31
Tsp45I GTSAC 1 cut(s) 31
TspDTI ATGAA 1 cut(s) 176
TspRI CASTG 1 cut(s) 109
VpaK11BI GGWCC 1 cut(s) 171
XspI CTAG 2 cut(s) 92, 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.