Rorug06G0119900

HEAT-like repeat

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Forward (+)
16453085 .. 16453306
222 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0119900.1

Sequence Viewer

Length: 222 bp
ATGCTTACTTCCCCTTTGGCTTTTGATCAATTTCCTAACAGTAGGCGAATTGTTGAAGAGTGGAAGATTGGCCTTCAGAGGGTTAAGAGAGAGGTCAAGGTGATTAAAAAAAAAAGTCTGGGTTCCCGAAATGGGCCTGGGCCTGACCCGATCCCAATCGGTTTCAGTATCATCTGTACCAGCTTTGAAAAATCGAAGTCTCATCCTGAAAAATATTTTTAG

Protein Analysis

73

Amino Acids

8.35

Weight (kDa)

10.01

Isoelectric Point (pI)

42.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 145
AcuI CTGAAG 1 cut(s) 59
AfaI GTAC 1 cut(s) 178
AfiI CCNNNNNNNGG 2 cut(s) 79, 132
AgsI TTSAA 2 cut(s) 56, 188
AjnI CCWGG 1 cut(s) 136
AluBI AGCT 1 cut(s) 183
AluI AGCT 1 cut(s) 183
Alw26I GTCTC 1 cut(s) 204
AlwI GGATC 1 cut(s) 145
AoxI GGCC 3 cut(s) 70, 134, 140
AspS9I GGNCC 2 cut(s) 134, 140
AsuHPI GGTGA 1 cut(s) 112
BciT130I CCWGG 1 cut(s) 138
BclI TGATCA 1 cut(s) 25
BcoDI GTCTC 1 cut(s) 204
Bme1390I CCNGG 1 cut(s) 138
BmgT120I GGNCC 2 cut(s) 134, 140
BmiI GGNNCC 1 cut(s) 124
BmrFI CCNGG 1 cut(s) 138
BsaBI GATNNNNATC 1 cut(s) 155
BsaJI CCNNGG 1 cut(s) 137
Bsc4I CCNNNNNNNGG 2 cut(s) 79, 132
Bse8I GATNNNNATC 1 cut(s) 155
BseBI CCWGG 1 cut(s) 138
BseDI CCNNGG 1 cut(s) 137
BseGI GGATG 1 cut(s) 202
BseJI GATNNNNATC 1 cut(s) 155
BseLI CCNNNNNNNGG 2 cut(s) 79, 132
BshFI GGCC 3 cut(s) 72, 136, 142
BslI CCNNNNNNNGG 2 cut(s) 79, 132
BsmAI GTCTC 1 cut(s) 204
BsnI GGCC 3 cut(s) 72, 136, 142
Bsp143I GATC 2 cut(s) 25, 150
BspANI GGCC 3 cut(s) 72, 136, 142
BspLI GGNNCC 1 cut(s) 124
BspPI GGATC 1 cut(s) 145
BssECI CCNNGG 1 cut(s) 137
BssMI GATC 2 cut(s) 25, 150
Bst2UI CCWGG 1 cut(s) 138
Bst4CI ACNGT 1 cut(s) 41
Bst6I CTCTTC 1 cut(s) 51
BstF5I GGATG 1 cut(s) 202
BstKTI GATC 2 cut(s) 28, 153
BstMAI GTCTC 1 cut(s) 204
BstMBI GATC 2 cut(s) 25, 150
BstNI CCWGG 1 cut(s) 138
BstSCI CCNGG 1 cut(s) 136
BsuRI GGCC 3 cut(s) 72, 136, 142
BtsCI GGATG 1 cut(s) 202
Cfr13I GGNCC 2 cut(s) 134, 140
Csp6I GTAC 1 cut(s) 177
CviJI RGCY 5 cut(s) 20, 72, 136, 142, 183
CviKI_1 RGCY 5 cut(s) 20, 72, 136, 142, 183
CviQI GTAC 1 cut(s) 177
DpnI GATC 2 cut(s) 27, 152
DpnII GATC 2 cut(s) 25, 150
Eam1104I CTCTTC 1 cut(s) 51
EarI CTCTTC 1 cut(s) 51
Eco57I CTGAAG 1 cut(s) 59
EcoRII CCWGG 1 cut(s) 136
FbaI TGATCA 1 cut(s) 25
FokI GGATG 1 cut(s) 189
HaeIII GGCC 3 cut(s) 72, 136, 142
HphI GGTGA 1 cut(s) 112
Hpy188I TCNGA 1 cut(s) 78
Hpy188III TCNNGA 2 cut(s) 126, 206
HpyAV CCTTC 1 cut(s) 83
HpyCH4III ACNGT 1 cut(s) 41
Ksp22I TGATCA 1 cut(s) 25
Kzo9I GATC 2 cut(s) 25, 150
LpnPI CCDG 5 cut(s) 104, 123, 150, 156, 193
MalI GATC 2 cut(s) 27, 152
MboI GATC 2 cut(s) 25, 150
MboII GAAGA 2 cut(s) 68, 76
MluCI AATT 2 cut(s) 29, 48
MnlI CCTC 2 cut(s) 72, 85
MseI TTAA 2 cut(s) 84, 105
MspR9I CCNGG 1 cut(s) 138
MvaI CCWGG 1 cut(s) 138
NdeII GATC 2 cut(s) 25, 150
NlaIV GGNNCC 1 cut(s) 124
Psp6I CCWGG 1 cut(s) 136
PspGI CCWGG 1 cut(s) 136
PspN4I GGNNCC 1 cut(s) 124
PspPI GGNCC 2 cut(s) 134, 140
RsaI GTAC 1 cut(s) 178
RsaNI GTAC 1 cut(s) 177
SaqAI TTAA 2 cut(s) 84, 105
Sau3AI GATC 2 cut(s) 25, 150
Sau96I GGNCC 2 cut(s) 134, 140
ScrFI CCNGG 1 cut(s) 138
SetI ASST 3 cut(s) 96, 102, 185
SgeI CNNG 9 cut(s) 109, 131, 138, 149, 150, 155, 160, 192, 218
Sse9I AATT 2 cut(s) 29, 48
SspI AATATT 1 cut(s) 215
StyD4I CCNGG 1 cut(s) 136
TaaI ACNGT 1 cut(s) 41
TaqI TCGA 1 cut(s) 194
TasI AATT 2 cut(s) 29, 48
Tru1I TTAA 2 cut(s) 84, 105
Tru9I TTAA 2 cut(s) 84, 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.