AT3G05880

hydrophobic protein

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Reverse (-)
1755497 .. 1756924
1428 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G05880.1

Sequence Viewer

Length: 165 bp
ATGAGTACAGCTACTTTCGTTGATATTATTATCGCCATCCTCTTGCCTCCACTCGGTGTCTTTCTCAGATTTGGTTGCGGGGTTGAGTTTTGGATATGTTTGGTTTTGACGCTACTTGGGTATATTCCTGGGATCATATACGCCATTTATGTCCTCACCAAATGA

Protein Analysis

54

Amino Acids

5.96

Weight (kDa)

5.82

Isoelectric Point (pI)

35.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pmp3 PF01679 6 - 52 5.9e-22 Proteolipid membrane potential modulator
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 78
AclWI GGATC 1 cut(s) 140
AdeI CACNNNGTG 1 cut(s) 56
AfaI GTAC 1 cut(s) 7
AfiI CCNNNNNNNGG 1 cut(s) 53
AjnI CCWGG 1 cut(s) 127
AluBI AGCT 1 cut(s) 11
AluI AGCT 1 cut(s) 11
AlwI GGATC 1 cut(s) 140
AsuHPI GGTGA 1 cut(s) 148
BccI CCATC 1 cut(s) 44
BciT130I CCWGG 1 cut(s) 129
Bme1390I CCNGG 1 cut(s) 129
BmrFI CCNGG 1 cut(s) 129
BsaJI CCNNGG 1 cut(s) 128
Bsc4I CCNNNNNNNGG 1 cut(s) 53
BseBI CCWGG 1 cut(s) 129
BseDI CCNNGG 1 cut(s) 128
BseGI GGATG 1 cut(s) 36
BseLI CCNNNNNNNGG 1 cut(s) 53
BseMII CTCAG 1 cut(s) 79
BslI CCNNNNNNNGG 1 cut(s) 53
Bsp143I GATC 1 cut(s) 132
BspACI CCGC 1 cut(s) 78
BspCNI CTCAG 1 cut(s) 78
BspPI GGATC 1 cut(s) 140
BssECI CCNNGG 1 cut(s) 128
BssMI GATC 1 cut(s) 132
Bst2UI CCWGG 1 cut(s) 129
BstDEI CTNAG 1 cut(s) 65
BstF5I GGATG 1 cut(s) 36
BstKTI GATC 1 cut(s) 135
BstMBI GATC 1 cut(s) 132
BstNI CCWGG 1 cut(s) 129
BstSCI CCNGG 1 cut(s) 127
BtsCI GGATG 1 cut(s) 36
CseI GACGC 1 cut(s) 118
Csp6I GTAC 1 cut(s) 6
CviJI RGCY 1 cut(s) 11
CviKI_1 RGCY 1 cut(s) 11
CviQI GTAC 1 cut(s) 6
DdeI CTNAG 1 cut(s) 65
DpnI GATC 1 cut(s) 134
DpnII GATC 1 cut(s) 132
DraIII CACNNNGTG 1 cut(s) 56
EcoRII CCWGG 1 cut(s) 127
FaiI YATR 5 cut(s) 97, 123, 137, 139, 150
FauI CCCGC 1 cut(s) 71
FokI GGATG 1 cut(s) 23
HgaI GACGC 1 cut(s) 118
HphI GGTGA 1 cut(s) 148
Hpy188I TCNGA 1 cut(s) 68
HpyF3I CTNAG 1 cut(s) 65
Kzo9I GATC 1 cut(s) 132
LpnPI CCDG 2 cut(s) 114, 141
MalI GATC 1 cut(s) 134
MboI GATC 1 cut(s) 132
MnlI CCTC 3 cut(s) 50, 57, 164
MspR9I CCNGG 1 cut(s) 129
MvaI CCWGG 1 cut(s) 129
NdeII GATC 1 cut(s) 132
Psp6I CCWGG 1 cut(s) 127
PspGI CCWGG 1 cut(s) 127
RsaI GTAC 1 cut(s) 7
RsaNI GTAC 1 cut(s) 6
Sau3AI GATC 1 cut(s) 132
ScrFI CCNGG 1 cut(s) 129
SetI ASST 1 cut(s) 13
SgeI CNNG 6 cut(s) 55, 65, 91, 128, 140, 141
SsiI CCGC 1 cut(s) 78
StyD4I CCNGG 1 cut(s) 127
TatI WGTACW 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.