Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr12

Orthogroup ID

OG0004002

Physical Location & Seq

Genomic Coordinates Forward (+)

19912749 .. 19913498

Gene Structure 750 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD12G1124100.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 168 bp

ATGAGGACATGCGTAGAAGTCGTGTGTGCCATAATTCTTCCACCAGTTGGCGTCATCATTCGCTATGGCTGTGCGGTGGAGTTTTGGATTGCCTTATTGCTGACGCTATTTGGGTATATACCAGGAATTATATATGCACTTTATGTCATATTACGAGAAACTTCCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pmp3

Protein Analysis

56

Amino Acids

6.15

Weight (kDa)

5.98

Isoelectric Point (pI)

24.32

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Pmp3	PF01679	4 - 51	4.8e-20	Proteolipid membrane potential modulator

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004002)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G57550 AT3G05880 AT3G05890
fragaria_vesca	FvH4_6g15380
malus_domestica	MD04G1104200.v1.1 MD04G1185600.v1.1 MD04G1185700.v1.1 MD04G1185900.v1.1 MD12G1124100.v1.1 MD12G1199100.v1.1 MD12G1199200.v1.1 MD12G1199300.v1.1
prunus_persica	Prupe.6G241100_v2.0.a1 Prupe.6G303600_v2.0.a1 Prupe.6G303700_v2.0.a1
pyrus_communis	pycom12g18540 pycom12g18550 pycom12g18570
rosa_chinensis	RchiOBHm_Chr3g0458631 RchiOBHm_Chr3g0458641 RchiOBHm_Chr3g0468861
rosa_multiflora	Rmu_sc0001639.1_g000017
rosa_roxburghii	Rroxscaffold_6G00412510 Rroxscaffold_6G00420890
rosa_rugosa	Rorug03G0030500 Rorug03G0030600.1 Rorug03G0030700.1 Rorug03G0030800
rosa_samantha	Rh3DG092600 Rh7DG019500
rosa_wichuraiana	Rw3G007570 Rw3G007580 Rw3G013800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	47
AciI	CCGC	1 cut(s)	74
AcyI	GRCGYC	1 cut(s)	51
AfiI	CCNNNNNNNGG	1 cut(s)	47
AjnI	CCWGG	1 cut(s)	121
BciT130I	CCWGG	1 cut(s)	123
Bme1390I	CCNGG	1 cut(s)	123
BmrFI	CCNGG	1 cut(s)	123
BsaHI	GRCGYC	1 cut(s)	51
Bsc4I	CCNNNNNNNGG	1 cut(s)	47
Bse1I	ACTGG	1 cut(s)	44
BseBI	CCWGG	1 cut(s)	123
BseLI	CCNNNNNNNGG	1 cut(s)	47
BseNI	ACTGG	1 cut(s)	44
BslI	CCNNNNNNNGG	1 cut(s)	47
BspACI	CCGC	1 cut(s)	74
BsrI	ACTGG	1 cut(s)	44
BssNI	GRCGYC	1 cut(s)	51
Bst2UI	CCWGG	1 cut(s)	123
BstACI	GRCGYC	1 cut(s)	51
BstNI	CCWGG	1 cut(s)	123
BstNSI	RCATGY	1 cut(s)	12
BstSCI	CCNGG	1 cut(s)	121
CseI	GACGC	2 cut(s)	40, 112
CviAII	CATG	1 cut(s)	9
CviJI	RGCY	1 cut(s)	69
CviKI_1	RGCY	1 cut(s)	69
EcoRII	CCWGG	1 cut(s)	121
FaeI	CATG	1 cut(s)	12
FatI	CATG	1 cut(s)	8
HgaI	GACGC	2 cut(s)	40, 112
Hin1I	GRCGYC	1 cut(s)	51
Hin1II	CATG	1 cut(s)	12
HpyCH4V	TGCA	1 cut(s)	137
Hsp92I	GRCGYC	1 cut(s)	51
Hsp92II	CATG	1 cut(s)	12
LpnPI	CCDG	3 cut(s)	57, 108, 135
MboII	GAAGA	1 cut(s)	29
MluCI	AATT	2 cut(s)	33, 126
MspR9I	CCNGG	1 cut(s)	123
MvaI	CCWGG	1 cut(s)	123
NlaIII	CATG	1 cut(s)	12
NspI	RCATGY	1 cut(s)	12
PflMI	CCANNNNNTGG	1 cut(s)	47
Psp6I	CCWGG	1 cut(s)	121
PspGI	CCWGG	1 cut(s)	121
ScrFI	CCNGG	1 cut(s)	123
SgeI	CNNG	5 cut(s)	21, 34, 56, 134, 135
Sse9I	AATT	2 cut(s)	33, 126
SsiI	CCGC	1 cut(s)	74
StyD4I	CCNGG	1 cut(s)	121
TasI	AATT	2 cut(s)	33, 126
Van91I	CCANNNNNTGG	1 cut(s)	47
XceI	RCATGY	1 cut(s)	12

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.