MD12G1199100.v1.1

hydrophobic protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
OG0004002
Physical Location & Seq
Forward (+)
28012629 .. 28014520
1892 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1199100.v1.1.491

Sequence Viewer

Length: 168 bp
ATGGGTTCAGCAACCTTCATCGACATCATCATCGCCATCCTCTTGCCACCTCTTGGTGTCTTCCTCAAGTATGAGTGTCGTGCGGAATTTTGGATCTGTTTGGTGCTGACACTGTTTGGTTACCTCCCTGGTATTATATATGCCATCTATATCCTCACCAAGTGGTAA

Protein Analysis

56

Amino Acids

6.3

Weight (kDa)

5.93

Isoelectric Point (pI)

39.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pmp3 PF01679 6 - 52 2.8e-21 Proteolipid membrane potential modulator
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 53
AciI CCGC 1 cut(s) 83
AclWI GGATC 1 cut(s) 101
AcsI RAATTY 1 cut(s) 86
AdeI CACNNNGTG 1 cut(s) 162
AfiI CCNNNNNNNGG 1 cut(s) 53
AjnI CCWGG 1 cut(s) 127
AlwI GGATC 1 cut(s) 101
ApoI RAATTY 1 cut(s) 86
AsuHPI GGTGA 1 cut(s) 148
BbsI GAAGAC 1 cut(s) 52
BccI CCATC 2 cut(s) 44, 152
BciT130I CCWGG 1 cut(s) 129
Bme1390I CCNGG 1 cut(s) 129
BmrFI CCNGG 1 cut(s) 129
BpiI GAAGAC 1 cut(s) 52
BpuEI CTTGAG 1 cut(s) 50
BsaJI CCNNGG 1 cut(s) 127
Bsc4I CCNNNNNNNGG 1 cut(s) 53
BseBI CCWGG 1 cut(s) 129
BseDI CCNNGG 1 cut(s) 127
BseGI GGATG 1 cut(s) 36
BseLI CCNNNNNNNGG 1 cut(s) 53
BslI CCNNNNNNNGG 1 cut(s) 53
Bsp143I GATC 1 cut(s) 93
BspACI CCGC 1 cut(s) 83
BspPI GGATC 1 cut(s) 101
BssECI CCNNGG 1 cut(s) 127
BssMI GATC 1 cut(s) 93
Bst2UI CCWGG 1 cut(s) 129
Bst4CI ACNGT 1 cut(s) 114
BstEII GGTNACC 1 cut(s) 119
BstF5I GGATG 1 cut(s) 36
BstKTI GATC 1 cut(s) 96
BstMBI GATC 1 cut(s) 93
BstNI CCWGG 1 cut(s) 129
BstPI GGTNACC 1 cut(s) 119
BstSCI CCNGG 1 cut(s) 127
BstV2I GAAGAC 1 cut(s) 52
BstX2I RGATCY 1 cut(s) 93
BstYI RGATCY 1 cut(s) 93
BtgZI GCGATG 1 cut(s) 16
BtsCI GGATG 1 cut(s) 36
BtsIMutI CAGTG 1 cut(s) 110
DpnI GATC 1 cut(s) 95
DpnII GATC 1 cut(s) 93
DraIII CACNNNGTG 1 cut(s) 162
Eco91I GGTNACC 1 cut(s) 119
EcoO65I GGTNACC 1 cut(s) 119
EcoRII CCWGG 1 cut(s) 127
FaiI YATR 5 cut(s) 72, 137, 139, 141, 150
FokI GGATG 1 cut(s) 23
HphI GGTGA 1 cut(s) 148
HpyAV CCTTC 1 cut(s) 25
HpyCH4III ACNGT 1 cut(s) 114
Kzo9I GATC 1 cut(s) 93
LpnPI CCDG 2 cut(s) 114, 141
MaeIII GTNAC 1 cut(s) 119
MalI GATC 1 cut(s) 95
MboI GATC 1 cut(s) 93
MboII GAAGA 1 cut(s) 52
MflI RGATCY 1 cut(s) 93
MluCI AATT 1 cut(s) 86
MnlI CCTC 5 cut(s) 50, 60, 74, 134, 164
MspR9I CCNGG 1 cut(s) 129
MvaI CCWGG 1 cut(s) 129
NdeII GATC 1 cut(s) 93
PflMI CCANNNNNTGG 1 cut(s) 53
Psp6I CCWGG 1 cut(s) 127
PspEI GGTNACC 1 cut(s) 119
PspGI CCWGG 1 cut(s) 127
PsuI RGATCY 1 cut(s) 93
Sau3AI GATC 1 cut(s) 93
ScrFI CCNGG 1 cut(s) 129
SetI ASST 3 cut(s) 17, 52, 126
SgeI CNNG 6 cut(s) 55, 65, 79, 92, 140, 141
SmlI CTYRAG 1 cut(s) 65
SmoI CTYRAG 1 cut(s) 65
Sse9I AATT 1 cut(s) 86
SsiI CCGC 1 cut(s) 83
StyD4I CCNGG 1 cut(s) 127
TaaI ACNGT 1 cut(s) 114
TaqI TCGA 1 cut(s) 21
TasI AATT 1 cut(s) 86
TscAI CASTG 1 cut(s) 117
TspDTI ATGAA 1 cut(s) 7
TspRI CASTG 1 cut(s) 117
Van91I CCANNNNNTGG 1 cut(s) 53
XapI RAATTY 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.