MD04G1185900.v1.1

Hydrophobic protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
Physical Location & Seq
Forward (+)
27673915 .. 27675738
1824 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1185900.v1.1.491

Sequence Viewer

Length: 174 bp
ATGCCGAGCGAAGGAACCCTAAACTTCGTCGACATCCTCATCGCCATCCTCTTGCCTCCTCTTGGTGTCTTCCTCAAGTTTGGCTGCCATGTGGAATTCTGGATCTGTTTGTTGCTGACCATTTTTGGTTACATCCCTGGGATTATCTACGCCATCTATGCCATCACCAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.37

Weight (kDa)

5.43

Isoelectric Point (pI)

43.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pmp3 PF01679 9 - 55 3.6e-21 Proteolipid membrane potential modulator
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 30
AclWI GGATC 1 cut(s) 110
AcsI RAATTY 1 cut(s) 95
AfiI CCNNNNNNNGG 2 cut(s) 11, 62
AjnI CCWGG 1 cut(s) 136
AlwI GGATC 1 cut(s) 110
ApeKI GCWGC 1 cut(s) 84
ApoI RAATTY 1 cut(s) 95
AsuHPI GGTGA 1 cut(s) 157
BbsI GAAGAC 1 cut(s) 61
BbvI GCAGC 1 cut(s) 71
BccI CCATC 3 cut(s) 53, 161, 170
BciT130I CCWGG 1 cut(s) 138
BisI GCNGC 1 cut(s) 85
BlsI GCNGC 1 cut(s) 86
Bme1390I CCNGG 1 cut(s) 138
BmiI GGNNCC 1 cut(s) 16
BmrFI CCNGG 1 cut(s) 138
BpiI GAAGAC 1 cut(s) 61
BpuEI CTTGAG 1 cut(s) 59
BsaJI CCNNGG 2 cut(s) 136, 137
Bsc4I CCNNNNNNNGG 2 cut(s) 11, 62
BseBI CCWGG 1 cut(s) 138
BseDI CCNNGG 2 cut(s) 136, 137
BseGI GGATG 3 cut(s) 33, 45, 132
BseLI CCNNNNNNNGG 2 cut(s) 11, 62
BseRI GAGGAG 1 cut(s) 48
BseXI GCAGC 1 cut(s) 71
BslI CCNNNNNNNGG 2 cut(s) 11, 62
Bsp143I GATC 1 cut(s) 102
BspLI GGNNCC 1 cut(s) 16
BspPI GGATC 1 cut(s) 110
BssECI CCNNGG 2 cut(s) 136, 137
BssMI GATC 1 cut(s) 102
Bst2UI CCWGG 1 cut(s) 138
BstF5I GGATG 3 cut(s) 33, 45, 132
BstKTI GATC 1 cut(s) 105
BstMBI GATC 1 cut(s) 102
BstMWI GCNNNNNNNGC 1 cut(s) 158
BstNI CCWGG 1 cut(s) 138
BstSCI CCNGG 1 cut(s) 136
BstV1I GCAGC 1 cut(s) 71
BstV2I GAAGAC 1 cut(s) 61
BstX2I RGATCY 1 cut(s) 102
BstYI RGATCY 1 cut(s) 102
BtgZI GCGATG 1 cut(s) 25
BtsCI GGATG 3 cut(s) 33, 45, 132
CviAII CATG 1 cut(s) 89
CviJI RGCY 1 cut(s) 84
CviKI_1 RGCY 1 cut(s) 84
DpnI GATC 1 cut(s) 104
DpnII GATC 1 cut(s) 102
EcoRI GAATTC 1 cut(s) 95
EcoRII CCWGG 1 cut(s) 136
FaeI CATG 1 cut(s) 92
FaiI YATR 2 cut(s) 90, 159
FatI CATG 1 cut(s) 88
FblI GTMKAC 1 cut(s) 30
Fnu4HI GCNGC 1 cut(s) 85
FokI GGATG 3 cut(s) 20, 32, 119
Fsp4HI GCNGC 1 cut(s) 85
GluI GCNGC 1 cut(s) 85
Hin1II CATG 1 cut(s) 92
HincII GTYRAC 1 cut(s) 31
HindII GTYRAC 1 cut(s) 31
HphI GGTGA 1 cut(s) 157
Hpy166II GTNNAC 1 cut(s) 31
Hpy188III TCNNGA 1 cut(s) 100
Hpy8I GTNNAC 1 cut(s) 31
Hpy99I CGWCG 1 cut(s) 32
HpyAV CCTTC 1 cut(s) 5
HpyF10VI GCNNNNNNNGC 1 cut(s) 158
Hsp92II CATG 1 cut(s) 92
Kzo9I GATC 1 cut(s) 102
LpnPI CCDG 3 cut(s) 85, 123, 150
Lsp1109I GCAGC 1 cut(s) 71
MaeIII GTNAC 1 cut(s) 128
MalI GATC 1 cut(s) 104
MboI GATC 1 cut(s) 102
MboII GAAGA 1 cut(s) 61
MflI RGATCY 1 cut(s) 102
MluCI AATT 1 cut(s) 95
MnlI CCTC 5 cut(s) 47, 59, 66, 69, 83
MspR9I CCNGG 1 cut(s) 138
MvaI CCWGG 1 cut(s) 138
MwoI GCNNNNNNNGC 1 cut(s) 158
NdeII GATC 1 cut(s) 102
NlaIII CATG 1 cut(s) 92
NlaIV GGNNCC 1 cut(s) 16
NmeAIII GCCGAG 1 cut(s) 30
PasI CCCWGGG 1 cut(s) 137
PkrI GCNGC 1 cut(s) 86
Psp6I CCWGG 1 cut(s) 136
PspGI CCWGG 1 cut(s) 136
PspN4I GGNNCC 1 cut(s) 16
PsuI RGATCY 1 cut(s) 102
SalI GTCGAC 1 cut(s) 29
SatI GCNGC 1 cut(s) 85
Sau3AI GATC 1 cut(s) 102
ScrFI CCNGG 1 cut(s) 138
SgeI CNNG 8 cut(s) 18, 64, 74, 88, 101, 112, 149, 150
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
Sse9I AATT 1 cut(s) 95
StyD4I CCNGG 1 cut(s) 136
TaqI TCGA 1 cut(s) 30
TasI AATT 1 cut(s) 95
TseI GCWGC 1 cut(s) 84
XapI RAATTY 1 cut(s) 95
XmiI GTMKAC 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.