Rroxscaffold_6G00412510

Proteolipid membrane potential modulator

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
35042443 .. 35042707
265 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00412510.1

Sequence Viewer

Length: 168 bp
ATGGGCGCATGCGCGACGTGCTGTGAAATCCTCCTCGCCATATTGCTTCCACCACTCGGCGTCGTCATCCGCTATGGCTGTGGGGTGGAGTTTTGGATCTGTTTGTTGCTGACGCTGTGCGGTTATATACCAGGAATTATATATGCAGTTTGTATCTTGCTTCAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

5.9

Weight (kDa)

4.53

Isoelectric Point (pI)

44.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pmp3 PF01679 7 - 53 2.6e-20 Proteolipid membrane potential modulator
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 14
AciI CCGC 2 cut(s) 70, 120
AclWI GGATC 1 cut(s) 104
AcuI CTGAAG 1 cut(s) 146
AcyI GRCGYC 1 cut(s) 60
AfiI CCNNNNNNNGG 1 cut(s) 56
AjiI CACGTC 1 cut(s) 18
AjnI CCWGG 1 cut(s) 130
AlwI GGATC 1 cut(s) 104
AspLEI GCGC 2 cut(s) 8, 14
BciT130I CCWGG 1 cut(s) 132
Bme1390I CCNGG 1 cut(s) 132
BmgBI CACGTC 1 cut(s) 18
BmrFI CCNGG 1 cut(s) 132
BsaHI GRCGYC 1 cut(s) 60
Bsc4I CCNNNNNNNGG 1 cut(s) 56
BseBI CCWGG 1 cut(s) 132
BseGI GGATG 1 cut(s) 66
BseLI CCNNNNNNNGG 1 cut(s) 56
BseRI GAGGAG 1 cut(s) 23
Bsh1236I CGCG 1 cut(s) 14
BslI CCNNNNNNNGG 1 cut(s) 56
Bsp143I GATC 1 cut(s) 96
BspACI CCGC 2 cut(s) 70, 120
BspFNI CGCG 1 cut(s) 14
BspPI GGATC 1 cut(s) 104
BssMI GATC 1 cut(s) 96
BssNI GRCGYC 1 cut(s) 60
Bst2UI CCWGG 1 cut(s) 132
BstACI GRCGYC 1 cut(s) 60
BstC8I GCNNGC 1 cut(s) 10
BstF5I GGATG 1 cut(s) 66
BstFNI CGCG 1 cut(s) 14
BstHHI GCGC 2 cut(s) 8, 14
BstKTI GATC 1 cut(s) 99
BstMBI GATC 1 cut(s) 96
BstMWI GCNNNNNNNGC 1 cut(s) 18
BstNI CCWGG 1 cut(s) 132
BstNSI RCATGY 1 cut(s) 12
BstSCI CCNGG 1 cut(s) 130
BstUI CGCG 1 cut(s) 14
BstX2I RGATCY 1 cut(s) 96
BstYI RGATCY 1 cut(s) 96
BtrI CACGTC 1 cut(s) 18
BtsCI GGATG 1 cut(s) 66
Cac8I GCNNGC 1 cut(s) 10
CfoI GCGC 2 cut(s) 8, 14
CseI GACGC 2 cut(s) 49, 121
CviAII CATG 1 cut(s) 9
CviJI RGCY 1 cut(s) 78
CviKI_1 RGCY 1 cut(s) 78
DpnI GATC 1 cut(s) 98
DpnII GATC 1 cut(s) 96
Eco57I CTGAAG 1 cut(s) 146
EcoRII CCWGG 1 cut(s) 130
FaeI CATG 1 cut(s) 12
FaiI YATR 8 cut(s) 10, 41, 75, 126, 128, 140, 142, 144
FatI CATG 1 cut(s) 8
FokI GGATG 1 cut(s) 53
GlaI GCGC 2 cut(s) 7, 13
HgaI GACGC 2 cut(s) 49, 121
HhaI GCGC 2 cut(s) 8, 14
Hin1I GRCGYC 1 cut(s) 60
Hin1II CATG 1 cut(s) 12
Hin6I GCGC 2 cut(s) 6, 12
HinP1I GCGC 2 cut(s) 6, 12
Hpy99I CGWCG 2 cut(s) 19, 65
HpyCH4IV ACGT 1 cut(s) 17
HpyCH4V TGCA 1 cut(s) 146
HpyF10VI GCNNNNNNNGC 1 cut(s) 18
HpySE526I ACGT 1 cut(s) 17
Hsp92I GRCGYC 1 cut(s) 60
Hsp92II CATG 1 cut(s) 12
HspAI GCGC 2 cut(s) 6, 12
Kzo9I GATC 1 cut(s) 96
LpnPI CCDG 2 cut(s) 117, 144
MaeII ACGT 1 cut(s) 17
MalI GATC 1 cut(s) 98
MboI GATC 1 cut(s) 96
MflI RGATCY 1 cut(s) 96
MluCI AATT 1 cut(s) 135
MnlI CCTC 2 cut(s) 41, 44
MspR9I CCNGG 1 cut(s) 132
MvaI CCWGG 1 cut(s) 132
MvnI CGCG 1 cut(s) 14
MwoI GCNNNNNNNGC 1 cut(s) 18
NdeII GATC 1 cut(s) 96
NlaIII CATG 1 cut(s) 12
NmeAIII GCCGAG 1 cut(s) 36
NspI RCATGY 1 cut(s) 12
PaeI GCATGC 1 cut(s) 12
Psp6I CCWGG 1 cut(s) 130
PspGI CCWGG 1 cut(s) 130
PsuI RGATCY 1 cut(s) 96
Sau3AI GATC 1 cut(s) 96
ScrFI CCNGG 1 cut(s) 132
SetI ASST 1 cut(s) 20
SgeI CNNG 7 cut(s) 21, 25, 30, 47, 68, 143, 144
SphI GCATGC 1 cut(s) 12
Sse9I AATT 1 cut(s) 135
SsiI CCGC 2 cut(s) 70, 120
StyD4I CCNGG 1 cut(s) 130
TaiI ACGT 1 cut(s) 20
TasI AATT 1 cut(s) 135
XceI RCATGY 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.